منافسة عامة قيد التنفيذ

تأمين المشخصات المخبرية للأمراض الحيوانية

المركز الوطني للوقاية من الآفات والامراض الحيوانية ومكافحتها

رقم المنافسة

250139001366

المعرّف

#887861

رقم المنافسة
250139001366
رقم المنافسة الداخلي
الجهة الحكومية
المركز الوطني للوقاية من الآفات والامراض الحيوانية ومكافحتها
الفرع / الإدارة
المركز الوطني للوقاية من الآفات النباتية والأمراض الحيوانية ومكافحتها (مركز وقاء)
نوع المنافسة
منافسة عامة
حالة المنافسة
تم اعتماد الترسية
طريقة تقديم العروض
ملفين منفصلين ( فني ومالي)
رسوم الاشتراك
500 ر.س
سعر كراسة الاشتراط
500 ر.س
تكلفة الدعوة
200 ر.س
تكلفة الشراء
500 ر.س
الضمان الإبتدائي
ضمان إبتدائى
الضمان النهائي
5.00%
مدة العقد
8 شهر
التأمين مطلوب
لا
مدة الوقفة (أيام)
5
داخل المملكة

عنوان الضمان الإبتدائى

لجنة فحص العروض

الغرض من المنافسة

تأمين المشخصات المخبرية للأمراض الحيوانية

التاريخ ميلادي هجري
تاريخ النشر 2025/01/26 10:26
آخر موعد للاستفسارات 2025/02/25 1446-08-26
آخر موعد تقديم العروض 2025/03/01 10:00 1446-09-01
موعد فتح العروض 2025/03/02 10:00 1446-09-02
موعد فحص العروض
التاريخ المتوقع للترسية 2025/02/27 1446-08-28
تاريخ بدء الأعمال 2025/03/10 1446-09-10
تاريخ خطاب تأكيد المشاركة
بداية إرسال الأسئلة 2025/02/27 1446-08-28
أقصى مدة للإجابة 10 يوم
مكان فتح العروض الكتروني عبر منصة مركز وقاء
مدة الوقفة 5 يوم

موقع التنفيذ

منطقة التنفيذ
منطقة الرياض
مدن التنفيذ
الرياض
موقع التنفيذ
داخل المملكة

مجال التصنيف

مجال التصنيف
غير مطلوب
يشمل مواد توريد
لا

الأنشطة

  • مستودعات الادوية والصيدليات - المستلزمات الطبية

جدول 1 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات فيروس مرض الليكوزس في الطيور ايه 25 نانومول 2 مشخص primers for avian leukosis (A) (25 nanomol): ALV A-F 5-GGCTTAGGCCAAAAGGGGT-3 ALV A-R 5-GTGCATTGCCACAGCGGTACTG-3 طقم 1 0
بادئات فيروس مرض الجمبورو العام 25 نانومول 10 مشخص primers for Gumboro (general) (25 nanomol): IBDV- F 5’- GCCCAGAGTCTACACCAT -3/IBDV-R 5’- CCCGGATTATGTCTTTGA -3 With positive control, each 25 nmol طقم 2 0
بادئات فيروس مرض الجمبورو الضاري مع الضابط الإيجابي 25 نانومول 10 مشخص primers for Gumboro (virulent strain) (25 nanomol): IBDVv -F 5’- CCGAGGCCACAGATAACCTTAAA -3’; IBDVv -R 5’- CCTCTAAACGGGTTGAAC -3’ With positive control, each 25 nmol. طقم 3 0
بادئات للتعرف على فيروس انفلونزا الطيور 10 مشخص primers forAvian Influenza virus (25 nanomol): common-uni12R (5’-GCCGGAGCTCTGCAGATATCAGCRAAAGCAGG-3’) common-uni12G(5’-GCCGGAGCTCTGCAGATATCAGCGAAAGCAGG-3’) common-uni13 (5’-CAGGAAACAGCTATGACAGTAGAAACAAGG-3’) عدد 4 0
بادئات للتعرف على فيروس التهاب الشعب الهوائية المعدي 22 وحدة 2 مشخص primers for infectious bronchitis virus (25 nanomol): 22 units عدد 5 0

5 بند

جدول 2 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات للتعرف على فيروس النيوكاسل 24 وحدة 2 مشخص primers for Newcastle disease virus (NDV) (25 nanomol): 24 units عدد 1 0
بادئات للتعرف على فيروس الجمبورو 8 وحدة 2 مشخص primers for Gumboro disease (IBD) (25 nanomol): 8 units عدد 2 0
بادئات فيروس مرض الليكوزس في الطيور العام 25 نانومول 2 مشخص primers for avian leukosis (general) (25 nanomol): ALV ALL-F 5-CGAGTGGCTCGCGAGATGG-3 ALV ALL-R 5-ACACTACATTTCCCCCTCCCTAT-3 طقم 3 0
بادئات فيروس مرض الليكوزس في الطيور بي 25 نانومول 2 مشخص primers for avian leukosis (B) (25 nanomol): ALVB -F 5-GGCTTTACCCCATACGATAG-3; ALVB -R 5-ACACATCCTGACAGATGGACCA-3 طقم 4 0
بادئات فيروس مرض الليكوزس في الطيور إي 25 نانومول 2 مشخص primers for avian leukosis (E) (25 nanomol): ALVE -F 5-GGCTTCGCCCCACTCCAA-3; ALVE-R 5-GCACATCTCCACAGGTGTAAAT-3 طقم 5 0
بادئات فيروس مرض الليكوزس في الطيور إي 25 نانومول 2 مشخص primers for avian leukosis (E) (25 nanomol): ALVE -F 5-GGCTTCGCCCCACTCCAA-3; ALVE-R 5-GCACATCTCCACAGGTGTAAAT-3 طقم 6 0

6 بند

جدول 3 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات فيروس مرض الليكوزس في الطيور جيه 25 نانومول 2 مشخص primers for avian leukosis (G) (25 nanomol): ALVJ-F 5-GGATGAGGTGACTAAGAAAG-3; ALVJ-R 5-CGAACCAAAGGTAACACACG-3 طقم 1 0
بادئات لفيروس مرض الريو في الطيور 25 نانومول 2 مشخص primers for avian Reovirus infections (25 nanomol): Reovirus -F 5’- ATTACGCAGAGGCATTT -3’; Reovirus -R 5’-CCCACTGCCGAATACA -3’ طقم 2 0
بادئات فيروس مرض أنيميا الدجاج 25 نانومول 2 مشخص Primers for chicken anaemia virus (25 nanomol): CAV- F 5’-GCAGTA GGT ATA CGC AAG GC -3’ /CAV- R 5’-CTG AACACC GTT GAT GGT C -3’ طقم 3 0
بادئات فيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 25 نانومول 2 مشخص primers for infectious laryngotracheitis virus in poultry (25 nanomol): ILTV – F 5’-CTCTTCCTCCTCTTCCTCAT -3 ; ILTV – R 5’-GTTACTGACTGAACCGACCC -3 طقم 4 0
بادئات للكشف عن فيروس النزيف الدموي في الأرانب 25 نانومول 2 مشخص primers for Rabbit hemorrhagic disease virus (RHDV) (25 nanomol): RHDV-F -5-CCACCACCAACACTTCAGGT -3 –/ RHDV- R –5- CAGGTTGAACACGAGTGTGC -3 – طقم 5 0

5 بند

جدول 4 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم إختبار تفاعل البلمرة المتسلسل التقليدي في خطوة واحدة100 تفاعل 1000 مشخص One Step RT-PCR Master Mix Kit: is designed for a Highly Efficient cDNA Synthesis and PCR in a single tube including the RNA template.supplied in a 2x concentration to perform standard PCR, Highly Efficient,high fidelity kit.,100 Reactions إختبار 1 0
طقم إختبار تفاعل البلمرة المتسلسل االلحظي بتقنية التاكمان 100 تفاعل 1000 مشخص TaqMan real-time PCR master mixe kit : 2X Master Mix for TaqMan probe-based real-time PCR (including: Taq HotStart DNA Polymerase, reaction buffer, dNTPs, and MgCl2 ). Optimized for high sensitivity and PCR yield .,100 Reactions إختبار 2 0
طقم اختبار الترسيب المناعي اختبار كوجين لفحص الأجسام المناعية ضد فيروس انيميا الخيل المعدى 10 مشخص Agar gel immunodiffusion (AGID) kit; Coggins Test for the detection of EIA antibodies in equine serum and plasma: The kit contains reference antigen and reference antisera(positive and negative) طقم 3 0
طقم اختبار التألق المناعي لتشخيص مرض السعار في الحيوانات 5 مشخص FITC Anti-rabies monoclonal antibody: Direct fluorescent antibody procedure for the invitro detection of rabies in brains and submaxillary glands of animals. The kit contains lyophilized FDI FITC Anti-rabies monoclonal antibody (with Evans blue counterstain) طقم 4 0
طقم اختبار التألق المناعي للكشف عن التهاب الانف والقصبة الهوائية المعدي في الابقار 3 مشخص طقم اختبار التألق المناعي للكشف عن التهاب الانف والقصبة الهوائية المعدي في الابقار. Bovine Herpesvirus Type 1/ immunofluorescence test Infectious Bovine Rhinotracheitis (BHV1/IBR) FA control slide FA Substrate Slide 12 well Positive Control for IFA (bovine) 1 ml Negative Control for IFA (bovine) 1 ml FITC Conjugate (porcine) 1 ml FITC Conjugate (porcine) 10 ml طقم 5 0

5 بند

جدول 5 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اختبار التألق المناعي للكشف عن اسهال الابقار الفيروسي 3 مشخص طقم اختبار التألق المناعي للكشف عن اسهال الابقار الفيروسي Bovine Viral Diarrhea Virus immunofluorescence test (BVDV) AF control slide 2 wells. FA (BVDV) substrate slide 12 well. Positive Controlfor IFA (bovine) 1 ml Negative Control for IFA (bovine) 1 ml FITC Conjugate (porcine) 1 ml FITC Conjugate (porcine) 10 ml طقم 1 0
طقم اختبار تثبيت المتممة CFT للكشف عن مرض الرعام في الخيول 10 مشخص Complement fixation test (CFT) to detect Glander disease in horse, 450 reactions CFT BUFFER CALCIUM MAGNESIUM (pH 7.2) ANTIGEN (A protein Suspension of Burkholderia mallei) 10ml t320 (VABUR002981) • Positive sera: Serum Burkholderia mallei POZ, 5ml (VSEBU001973) • Freeze-dried Guinea-pig, 5ml complement (c) CPLT 2X5ml. • Rabbit hemolytic anti-RBG serum (heamolysin H). • Kit should include all reagents and materials needed. طقم 2 0
طقم اختبار تثبيت المتممة للكشف عن مرض الدورين في الخيول 15 مشخص Complement fixation test (CFT) to detect Dourine (Trypanosoma equiperdium) disease in horse, 150 reactions • CFT BUFFER CALCIUM MAGNESIUM (pH 7.2) • ANTIGEN (A protein Suspension of Trypanosoma equiperdium) Dourine antigen (reference: S00656) • positive sera: Serum Trypanosoma equiperdium Low titre serum (reference: S655). High titre serum (reference: S654) • Freeze-dried Guinea-pig, 5ml complement (c) CPLT 2X5ml. • Rabbit hemolytic anti-RBG serum (heamolysin H). • Kit should include all reagents and materials needed. طقم 3 0
طقم إختبار تفاعل البلمرة المتسلسل اللحظي في خطوة واحدة بتقنية التاكمان100 تفاعل 2000 مشخص One StepTaqMan real time PCR Master Mix: The kits contain all reagents required for RT-qPCR to ensure fast and easy preparation (including:effecient cDNA synthesis, Taq HotStart DNA Polymerase, reaction buffer, dNTPs, and MgCl2 ).The Kit Optimized for high sensitivity and yield,100 Reactions إختبار 4 0
طقم إختبار تفاعل البلمرة المتسلسل التقليدي100 تفاعل 2000 مشخص Hot Start PCR Master Mix kit :is a ready-to-use 2X solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient PCR amplification of DNA templates. The PCR Master Mix is designed for routine endpoint PCR for DNA amplicons in the range of 0.2–2kb to cover routine PCR and High Fidelity PCR needs.PCR Master Mix is stable for 3 months when stored at 4°C.,100 Reactions إختبار 5 0

5 بند

جدول 6 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة ماسوشيتي لمرض التهاب الشعب الهوائية في الدجاج 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة ماسوشيتي لمرض لتهاب الشعب الهوائية في الدجاج Reference HI Antigen for IBV Mass. (M41) strain. Non-infectiou . Lyophilized. Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة D274 لمرض التهاب الشعب الهوائية في الدجاج 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة D274 (D207) لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antigen for IBV D274 (D207) strain Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antigen for IBV QX (D388) strain Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة 793B 4 91 CR88 لمرض التهاب اشعب الهوائية في الدجاج 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة 793B (4/91, CR88) لمرض التهاب اشعب الهوائية في الدجاج Reference HI Antigen for IBV 793B (4/91, CR88) strain Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لاختبار مانع التلازن الدموي لانفلونزا الطيور النوع أ 5 مشخص Reference HI Antigen for Avian Influenza type ANon-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 7 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان 1 5 مشخص Reference HI Antigen for Avian Influenza virus type H5N2 Lyophilized, Fully identified (including Antibody concentration) عبوة 1 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان2 5 مشخص Reference HI Antigen for Avian Influenza virus type H5N2 Lyophilized, Fully identified (including Antibody concentration) عبوة 2 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان8 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان8 Reference HI Antigen for Avian Influenza type H5N8 Non-infectious.Lyophilized, Fully identified (including virus concentration) عبوة 3 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان6 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان6 Reference HI Antigen for Avian Influenza type H5N6 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 9 ان 2 5 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 9 ان 2 Reference HI Antigen for Avian Influenza type H9N2 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 8 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان1 2 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان1 Reference HI Antigen for Avian Influenza type H7N1 Non-infectious.Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج 2 مشخص انتيجين مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج Reference AGID Antigen for Mareks disease virus in chicke . Lyophilized, Fully identified (including Antibody concentration) عبوة 2 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان2 2 مشخص انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان1 Reference HI Antigen for Avian Influenza type H7N1 Non-infectious.Lyophilized, Fully identified (including virus concentration) عبوة 3 0
انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا 2 مشخص انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا Reference HI Antiserum for Lentogenic (LaSota ) Strain Newcastle disease virus Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية 2 مشخص انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية Reference HI Antiserum for Mesogenic and velogenic Newcastle disease virus Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 9 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لفيروس مرض الليكوزس في الطيور النوع جيه 2 مشخص انتيجين مرجعي لفيروس مرض الليكوزس في الطيور النوع جيه Reference Antigen for Avian Leukosis virus Disease Subtype J Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لفيروس مرض أنيميا الطيور 2 مشخص انتيجين مرجعي لفيروس مرض أنيميا الطيور Reference Antigen for Avian chicken anemia virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
انتيجين مرجعي لفيروس مرض الجدري في الطيور 2 مشخص انتيجين مرجعي لفيروس مرض الجدري في الطيور Reference Antigen for Avian Pox Virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
انتيجين مرجعي لفيروس النزيف الدموي المعدي في الأرانب 2 مشخص انتيجين مرجعي لفيروس النزيف الدموي المعدي في الأرانب Reference Antigen for Rabbit Hemorrhagic septicemia viral disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لفيروس الالتهاب الوبائي الرعاش في الدجاج 2 مشخص Reference Antigen forAvian Encephalomyeilitis disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 10 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لفيروس مرض الليكوزس في الطيور 2 مشخص انتيجين مرجعي لفيروس مرض الليكوزس في الطيور Reference Antigen for Avian Leukosis virus Disease A Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 2 مشخص انتيجين مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور Reference Antigen for infectious Laryngeotracheitis virus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
انتيجين مرجعي لفيروس مرض الريو في الطيور 2 مشخص انتيجين مرجعي لفيروس مرض الريو في الطيور Reference Antigen for Reovirus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
انتيجين مرجعي لفيروس مرض النيمو في الطيور 2 مشخص انتيجين مرجعي لفيروس مرض النيمو في الطيور Reference Antigen for Pneumovirus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لفيروس مرض الأدينو في الدجاج 2 مشخص انتيجين مرجعي لفيروس مرض الأدينو في الدجاج FAV1 Reference Antigen for Fowl adenovirus disease FAV-1 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 11 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لفيروس تدني انتاج البيض في الدجاج 2 مشخص انتيجين مرجعي لفيروس تدني انتاج البيض في الدجاج Reference Antigen for Egg Drop Syndrome disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لفيروس النزيف الدموي في الأرانب 2 مشخص Reference Antigen for Rabbit Haemorrahgic Septcaemia Virus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
انتيجين مرجعي لفيروس مرض الجمبورو في الطيور 3 مشخص FOETAL CALF SERUM: 500ML/BOTTLE Sterile filtered suitable for cell culture (mammals) عبوة 3 0
انتيجين مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية 3 مشخص انتيجين مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية (Interfield 2512 strain) Reference Antigen for Infectious bursal Disease virus Virulent strain (Interfield 2512 strain) Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لاختبار التلازن الدموي لمرض انفلونزا الخيول نوع اتش 3 3 مشخص انتيجين مرجعي لاختبار التلازن الدموي لمرض انفلونزا الخيول نوع اتش 3 Reference HI Antigen for Equine Influenza subtype type H3 Non-infectious. Lyophilized. عبوة 5 0

5 بند

جدول 12 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لبكتيريا السل البقري 2 مشخص Reference Antigen forMycobacterium bovis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز B 3 مشخص Reference Antigen for Clostridium perfringens B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز C 3 مشخص Reference Antigen for Clostridium perfringens C Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز D 3 مشخص Reference Antigen for Clostridium perfringens D Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز E 3 مشخص Reference Antigen for Clostridium perfringens E Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0

5 بند

جدول 13 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لبكتيريا الكلوستيرديوم شوفياي 3 مشخص Reference Antigen for Clostridium Chauvoie Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم نوفياي 3 مشخص Reference Antigen for Clostridium novyi Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم سوردلى 3 مشخص Reference Antigen for Clostridium sordellii Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم سيبتكم 3 مشخص Reference Antigen for Clostridium septicum Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
انتيجين مرجعي لبكتيريا البروسيلا ميلتنسس 8 مشخص Reference Antigen for Brucella melitensis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0

5 بند

جدول 14 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لبكتيريا البروسيلا ابورتس 8 مشخص Reference Antigen for Brucella abortus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا A 5 مشخص Reference Antigen for pasteurella multocida A Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا D 5 مشخص Reference Antigen for pasteurella multocida D Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا B 5 مشخص Reference Antigen for pasteurella multocida B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا F 5 مشخص Reference Antigen for pasteurella multocida F Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0

5 بند

جدول 15 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا E 5 مشخص Reference Antigen for pasteurella multocida E Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
انتيجين مرجعي لبكتيريا المانهيميا هيموليتكا 5 مشخص Reference Antigen for Mannheimia Haemolytica Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجين مرجعي لبكتيريا المسببة لمرض خناق الخيل في الخيل 3 مشخص ا Reference Antigen for Strept equi Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتيجين مرجعي لبكتيريا المسببة لمرض الرعام في الخيل 3 مشخص Reference Antigen for Burkholderia mallei Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
انتيجين مرجعي لبكتيريا المايكوباكتيريوم باراتيوبركيلوزيس 5 مشخص Reference Antigen forMycobacterium paratuberculosis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0

5 بند

جدول 16 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي ل مجموعة المايكوباكتيريوم 2 مشخص Reference Antigen forMycobacterium complex Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
انتيجين مرجعي لبكتيريا السالمونيلا 5 مشخص Reference Antigen for Salmonella Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجين مرجعي لبكتيريا الاي كولاى 5 مشخص Reference Antigen for E.coli Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتيجين مرجعي لبكتيريا الكوكسيلا بيرنيتي 5 مشخص Reference Antigen for Coxeilla burnetii Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
انتيجين مرجعي لبكتيريا الكلاميديا ابورتس 5 مشخص Reference Antigen for Chlamydia abortus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0

5 بند

جدول 17 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار PCR لفيروس جدري الابل 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس جدري الأبل Reference PCR Antigen for Camel Pox virus: Non –infectious.Lyophilized عبوة 1 0
انتيجين مرجعي لفيروس مرض إلتهاب الجلد العقدي 3 مشخص انتيجين مرجعي لفيروس الجلد العقدي Reference PCR Antigen for Lumpy Skin Disease virus: Non –infectious.Lyophilized عبوة 2 0
انتيجين المرجعي لاختبار PCR لفيروس اللسان الأزرق 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس اللسان الأزرق Reference PCR Antigen for Blue Tongue virusfor all the availble strains(serotypes(36): Non –infectious.Lyophilized عبوة 3 0
انتيجين مرجعي لاختبار pcr لفايروس طاعون المجترات 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس طاعون المجترات Reference PCR Antigen for PPR virus: Non –infectious. Lyophilized عبوة 4 0
انتيجين مرجعي لاختبار pcr لفايروس الاسهال البقرى 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس الاسهال البقرى Reference PCR Antigen for BVDV virus: Non –infectious. Lyophilized عبوة 5 0

5 بند

جدول 18 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع O 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (O) Reference PCR Antigen for FMDV type O: Non –infectious.Lyophilized عبوة 1 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع A 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (A) Reference PCR Antigen for FMDV type A: Non –infectious.Lyophilized عبوة 2 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع Asia1 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (Asia1) Reference PCR Antigen for FMDV type Asia1: Non –infectious.Lyophilized عبوة 3 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع SAT1 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (SAT1) Reference PCR Antigen for FMDV type SAT1: Non –infectious.Lyophilized عبوة 4 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع SAT3 3 مشخص انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (SAT3) Reference PCR Antigen for FMDV type SAT3: Non –infectious.Lyophilized عبوة 5 0

5 بند

جدول 19 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار PCR لفيروس جدري الاغنام 2 مشخص انتيجين مرجعي لأختبارPCR لفيروس جدري الأغنام Reference PCR Antigen for Sheep Pox virus: Non –infectious.Lyophilized عبوة 1 0
انتيجين المرجعي لاختبار rt PCR لفيروس التهاب الشرايين الفيروسي في الخيل 2 مشخص انتيجين مرجعي لأختبارreal time PCR لفيروس التهاب الشرايين الخيلي Reference RT-rt PCR Antigen forequine arterities virus: Non –infectious.Lyophilized عبوة 2 0
انتيجين المرجعي لاختبار rt PCR لفيروس طاعون الخيل الافريقي 2 مشخص انتيجين مرجعي لأختبارreal time PCR لفيروس طاعون الخيل الافريقي ي Reference RT-rt PCR Antigen for african horse sickness virus: Non –infectious.Lyophilized عبوة 3 0
انتيجين المرجعي لاختبار rt PCR لفيروس هيربس 1و4 الخيلي 2 مشخص انتيجين مرجعي لأختبارreal time PCR لفيروس هربس 1 و4 الخيلي - Reference RT-rt PCR Antigen for equine herpes 1 & 4, virus: Non –infectious.Lyophilized عبوة 4 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع SAT2 4 مشخص انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (SAT2) Reference PCR Antigen for FMDV type SAT2: Non –infectious.Lyophilized عبوة 5 0

5 بند

جدول 20 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لأختبار real time PCR لفيروس انفلونزا الخيل 4 مشخص انتيجين مرجعي لأختبارreal time PCR لفيروسانفلونزا الخيل - Reference RT-rt PCR Antigen for equine influenza H3, N8, M2 virus: Non –infectious.Lyophilized عبوة 1 0
بادئات للكشف عن فيروس تدني انتاج البيض في الدجاج 25 نانومول 2 مشخص primers for Egg drop syndrome virus (EDS) (25 nanomol): EDS- F 5 – ttctgtcaccgataaaggt -3 / EDS-R 5 -agttattccaaatgggcat -3 طقم 2 0
بادئات فيروس الادينوفيرس 25 نانومول 2 مشخص Primers for Adeno virus (25 nanomol): FAV -F 5- ccctcccaccgcttacca-3 ; FAV -R 5 cacgttgcccttatcttgc -3 طقم 3 0
بادئات فيروس جدري الطيور 25 نانومول 2 مشخص Primers for Fowl Pox virus (25 nanomol): FPV -F 5’-ACG-ACC-TAT-GCG-TCT-TC-3 ; FPV-R 5’-ACG-CTT-GAT-ATC-TGG-ATG-3 طقم 4 0
بادئات فيروس الالتهاب الرعاش في الدجاج 25 نانومول 2 مشخص Primers for AvianEncephlo myeilitis virus (25 nanomol): AEV -F 5’CTTATGCTGGCCCTGATCGT-3 ; AEV-R 5’-TCCCAAATCCACAAACCTAGCC-3 طقم 5 0

5 بند

جدول 21 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم بادئات وبروبات للكشف عن فيرويد الدرنة المغزلية في البطاطس 5 مشخص طقم بادئات وبروبات للكشف عن فيرويد الدرنة المغزلية في البطاطس Primers and probes for the detection of Potato spindle tuber viroid. PSTVd-F: 5’-CCT TGG AAC CGC AGT TGG T-3’ (nt 339–357) PSTVd-R: 5’-TTT CCC CGG GGA TCC C-3’ (nt 87–102) PSTVdP: FAM-5’ TCCTGTGGTTCACACCTGACCTCCTGA-3’ TAMRA (nt 19–45) Positive control should be provided. Kit = 4800 tests طقم 1 0
طقم بادئات وبروبات للكشف عن فطر مونيلينيا فراكتيكولا 5 مشخص طقم بادئات وبروبات للكشف عن فطر مونيلينيا فراكتيكولا Primers and probes for the detection of Monilinia fructicola: For.: Mon139-F 5’-CACCCTTGTGTATYATTACTTTGTTGCTT-3’ Rev.: Mon139-R 5’-CAAGAGATCCGTTGTTGAAAGTTTTAA-3’ P_fc: FAM TATGCTCGCCAGAGGATAATT-MGBNFQ P2_fgn ⁄ lx ⁄ ps: VIC-AGTTTGRTTATTCTCTGGCGAb-MGBNFQ Positive control should be provided. Kit = 4800 tests طقم 2 0
طقم بادئات وبروبات للكشف عن فطر جيجنارديا سيتريكاربا 5 مشخص طقم بادئات وبروبات للكشف عن فطر جيجنارديا سيتريكاربا Primers and probes for the detection of Guignardia citricarpa: GcF1: 5’- GGTGAT GGA AGG GAG GCC T-3’ GcR1: 5’- GCA ACA TGG TAG ATA CAC AAGGGT -3’ GcP1: 5’- AAA AAGCCG CCC GAC CTA CCT TCA -3’ Positive control should be provided. Kit = 4800 tests طقم 3 0
طقم بادئات وبروبات للكشف عن فطر بليندوماس تريكيفيلا 5 مشخص طقم بادئات وبروبات للكشف عن فطر بليندوماس تريكيفيلا Primers and probes for the detection of Plendomus tracheiphilus: Phomafor: 5’-GCT GCG TCT GTC TCT TCT GA-3’ Phomarev: 5’-GTG TCC TAC AGG CAG GCAA-3’ Phomaprobe: 5’-FAM CCA CCA AGG AAA CAAAGG GTG CG BHQ-3’ Positive control should be provided. Kit = 4800 tests طقم 4 0
طقم بادئات وبروبات للكشف عن فطر تيليشيا انديكا 5 مشخص طقم بادئات وبروبات للكشف عن فطر تيليشيا انديكا Primers and probes for the detection of Tilletia indica: Tin 3-F: 5’-CAA TGT TGG CGT GGCGGC GC-3’ Tin 10-R: 5’-AGCTCCGCCTCAAGTTCCTC-3’ TaqMan probe [10 µM]: 5’ (FAM label)-ATT CCC GGC TTCGGC GTC ACT- (TAMRA quencher) 3’. Positive control should be provided. Kit = 4800 tests طقم 5 0

5 بند

جدول 22 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات لتشخيص فايروس الحمى القلاعية عام 5 مشخص بادئات لتشخيص فيروس الحمى القلاعية (عام) Primers for FMDV (universal اختبار 1 0
مجموعة بادئات للكشف عن الانماط الجينية للسان الازرق 27 نوع 1 مشخص مجموعة بادئات للكشف عن الانماط الجينية للسان الازرق (27 نوع) set of primers for detection of blue tongue serotypes (27 serotypes) طقم 2 0
بادئات للتعرف على مرض خناق الخيل في الخيل 2 مشخص بادئات للتعرف على مرض خناق الخيل في الخيل اختبار 3 0
بادئات للتعرف على مرض الرعام في الخيل 2 مشخص بادئات للتعرف على مرض الرعام في الخيل اختبار 4 0
بادئات للتعرف على مرض الجونز 2 مشخص بادئات للتعرف على مرض الجونز اختبار 5 0

5 بند

جدول 23 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات للتعرف على مرض السل البقري 2 مشخص بادئات للتعرف على مرض السل البقري اختبار 1 0
بادئات للتعرف على مجموعة المايكوباكتيريوم 2 مشخص بادئات للتعرف على مجموعة المايكوباكتيريوم اختبار 2 0
مجموعة بادئات لتحديد تسلسل قواعد الحمض النووي لفيروس الحمى القلاعية باختبار RT PCR 2 مشخص PRIMERS FOR RT-QPCR AND COMPLEMENTARY FIRST STRAND SYNTHESIS 3 PRIMER /GROUP عدد 3 0
مجموعة زوج بادئات للتعرف على فيروس جدري الإبل 1 مشخص Sets of primers for camel pox virus, 4 primer pairs/group عدد 4 0
مجموعة زوج بادئات للتعرف على فيروس جدري الماعز 1 مشخص Sets of primers for capripox virus, 7 primer pairs/group عدد 5 0

5 بند

جدول 24 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
مجموعة زوج بادئات للتعرف على الحمى القلاعية 1 مشخص Sets of primers for FMD virus. 23 primer/group (10نانومول/عبوة) طقم 1 0
مجموعة زوج بادئات للتعرف على طاعون المجترات 1 مشخص Set of primers for PPR virus. Partial genome sequencing of PPR. 8 primer pairs/group مجموعة زوج بادئات للتعرف على طاعون المجترات 10نانومول عبوة مجموعة 2 0
مجموعة بادئات فيروس طاعون الخيل الأفريقي 1 مشخص set of primers for detection of African Horse sickness serotypes (22 serotypes) عدد 3 0
مجموعة بادئات اللسان الأزرق 1 مشخص primers for detection of blue tongue عدد 4 0
زوج بادئات القراد 1 مشخص primers for detection of Tick عدد 5 0

5 بند

جدول 25 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
مجموعة بادئات البوريليا 1 مشخص primers for detection of Borelliae عدد 1 0
زوج بادئات حمى الكوكسيلا البورنيتية Q 5 مشخص primers for detection of Coxiella burnetii (Q Fever) عدد 2 0
زوج بادئات الريكيتسيال 1 مشخص primers for detection of rickettsial عدد 3 0
زوج بادئات بعوض الكيولكس كوينكيفيشيس 1 مشخص primers for detection of Culex quinquefasciatus عدد 4 0
بادئات كونسينساس 1 مشخص primer for detection of consensus CPI6 R عدد 5 0

5 بند

جدول 26 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات بعوض الكيوليكس بيبنز 1 مشخص primer for detection of Culex pipiens complex PQIO F عدد 1 0
زوج بادئات بعوض الإيديس 1 مشخص primers for detection of Aedes عدد 2 0
بادئات بعوض الإيديس فيتاتس 1 مشخص primers for detection of Aedes vittatus عدد 3 0
بادئات بعوض الإيديس إيجيبتاي 1 مشخص pimers for detection of Aedes aegypti عدد 4 0
بادئات بعوض الإيديس ألبوبيكتس 1 مشخص primers for detection of Aedes albopictus عدد 5 0

5 بند

جدول 27 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات بعوض الإيديس كاسبيس 1 مشخص primers for detection of Aedes caspius عدد 1 0
بادئات لمجموعة المايكوبلازما مايكويدس 5 مشخص Mycoplasma mycoides cluster specific primers: •5’-TTCTAAATTAGTTACTCGTGCA- 3’ •5’- AATAAACTGTATTCTCTAGCCA- 3’ عدد 2 0
بادئات للمايكوبلازما كابري كولم تحت فصيلة كابرينيوموني 5 مشخص Mycoplasma capricolum subspecies capripneumoniae primers: F: 5’-ATC-ATT-TTT-AAT-CCC-TTC-AAG-3’-R: 5’-TAC-TAT-GAG-TAA-TTA-TAA-TAT-ATG-CAA-3’ عدد 3 0
بادئات لتشخيص فايروس الحمى القلاعية النوعO 4 مشخص مجموعة بادئات لتشخيص فيروس الحمى القلاعية (النوع O) Primers for FMDV (Serotype O عدد 4 0
بادئات لتشخيص فايروس الحمى القلاعية النوعA 4 مشخص مجموعة بادئات لتشخيص فيروس الحمى القلاعية (النوع A) Primers for FMDV (Serotype A عدد 5 0

5 بند

جدول 28 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات لتشخيص فايروس الحمى القلاعية النوع Asia1 2 مشخص مجموعة بادئات لتشخيص فيروس الحمى القلاعية (النوع Asia1) Primers for FMDV (Serotype Asia1 عدد 1 0
بادئات لتشخيص فايروس الحمى القلاعية النوع SAT1 2 مشخص مجموعة بادئات لتشخيص فيروس الحمى القلاعية (النوع SAT1) Primers for FMDV (Serotype SAT1 عدد 2 0
بادئات لتشخيص فايروس الحمى القلاعية النوع SAT2 4 مشخص مجموعة بادئات لتشخيص فيروس الحمى القلاعية (النوعSAT2 ) Primers for FMDV (Serotype SAT2 عدد 3 0
بادئات لتشخيص فايروس الحمى القلاعية النوع SAT3 2 مشخص مجموعة بادئات لتشخيص فيروس الحمى القلاعية (النوع SAT3) Primers for FMDV (Serotype SAT3 عدد 4 0
مجموعة بادئات الإيديس فيكسان 2 مشخص primers for detection of Aedes vexans arabiensis عدد 5 0

5 بند

جدول 29 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات للكشف عن طفيل التريبانوسوما في الخيول 2 مشخص Primers for the detection of Equine trypanosomaisis ND5-F (50-TGGGTTTATATCAGGTTCATTTATG-30) ND5-R (50-CCCTAATAATCTCATCCGCAGTACG-30) عدد 1 0
سيرم مرجعي لفيروس مرض الليكوزس في الطيور جيه 3 مشخص سيرم مرجعي لفيروس مرض الليكوزس في الطيور جيه Reference Antiserum for Avian Leukosis virus Disease Subtype J Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
سيرم مرجعي لفيروس مرض أنيميا الطيور 3 مشخص سيرم مرجعي لفيروس مرض أنيميا الطيور Reference Antiserum for Avian chicken anemia virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
سيرم مرجعي لفيروس مرض الجدري في الطيور 3 مشخص سيرم مرجعي لفيروس مرض الجدري في الطيور Reference Antiserum for Avian Pox Virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
سيرم مرجعي لفيروس النزيف الدموي في الأرانب 3 مشخص Reference Antiserum for Rabbit Haemorrahgic Septcaemia Virus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 30 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي لفيروس الالتهاب الوبائي الرعاش في الدجاج 2 مشخص Reference Antiserum for Avian Encephalomyeilitis disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
سيرم مرجعي لفيروس مرض الليكوزس في الطيور 3 مشخص سيرم مرجعي لفيروس مرض الليكوزس في الطيور Reference Antiserum for Avian Leukosis virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
سيرم مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 3 مشخص سيرم مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور Reference Antiserum for infectious Laryngeotracheitis virus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
سيرم مرجعي لفيروس مرض الريو في الطيور 3 مشخص سيرم مرجعي لفيروس مرض الريو في الطيور Reference Antiserum for Reovirus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
سيرم مرجعي لفيروس مرض النيمو في الطيور 2 مشخص سيرم مرجعي لفيروس مرض النيمو في الطيور Reference Antiserum for Pneumovirus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 31 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي لفيروس مرض الأدينو في الدجاج 2 مشخص سيرم مرجعي لفيروس مرض الأدينو في الدجاج Reference Antiserum for Fowl adenovirus disease FAV-1 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
سيرم مرجعي لفيروس تدني انتاج البيض في الدجاج 2 مشخص سيرم مرجعي لفيروس تدني انتاج البيض في الدجاج Reference Antiserum for Egg Drop Syndrome disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
سيرم مرجعي لفيروس مرض التهاب الشرايين الفيروسي في الخيل 3 مشخص reference antisera for equine viral arterities (lyophilized 1 ml) عبوة 3 0
سيرم مرجعي لفيروس مرض طاعون الخيل الافريقي 5 مشخص reference antisera for african horse sickness (lyophilized 1 ml) عبوة 4 0
سيرم مرجعي لفيروس مرض انفلونزا الخيل H3 N8 7 مشخص reference antisera for equine influenza H3, N8 (lyophilized 1 ml) عبوة 5 0

5 بند

جدول 32 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي لفيروس مرض هربس 1 و 4 4 مشخص reference antisera for equine herpes 1 & 4 (lyophilized 1 ml) عبوة 1 0
سيرم مرجعي لفيروس مرض للسان الازرق 4 مشخص reference antisera for bluetongue virus (lyophilized 1 ml) عبوة 2 0
سيرم مرجعي لانماط المصلية لفيروس مرض للسان الازرق 27 عترة 1 مشخص reference antisera for bluetongue virus (27 serotypes) (lyophilized 1 ml) عدد 3 0
سيرم مرجعي ضد فيروس مرض حمى الوادي المتصدع IgG 5 مشخص reference antisera against Rift Vally Fever virus (IgG)(lyophilized 1 ml) عبوة 4 0
سيرم مرجعي ضد فيروس انيميا الخيل المعدي 5 مشخص reference antisera against Equine infectious Anemia virus (lyophilized 1 ml) عبوة 5 0

5 بند

جدول 33 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم عجول حديثي الولادة 5 مشخص Newborn calf serum: 500 ml/bottle Sterile-filtered suitable for cell culture (mammals) عبوة 1 0
سيرم جنين البقر 10 مشخص FOETAL CALF SERUM: 500ML/BOTTLE Sterile filtered suitable for cell culture (mammals) عبوة 2 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور نوع أ 8 مشخص Reference HI Antiserum for Avian Influenza virus type A Lyophilized, Fully identified (including Antibody concentration) عبوة 3 0
سيرم مرجعي ضد فيروس مرض حمى الوادي المتصدع IgM 5 مشخص reference antisera against Rift Vally Fever virus (IgM)(lyophilized 1 ml) عبوة 4 0
سيرم مرجعي لفيروس مرض الجمبورو في الطيور 3 مشخص سيرم مرجعي لفيروس مرض الجمبورو في الطيور Reference Antiserum for Infectious bursal Disease virus Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 34 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعى إيجابى ضعيف لمرض الرعام في الخيول 10 مشخص Hyperimmune antisera (weak) against Burkholderia mallei Lyophilized. - 1ml/container- عبوة 1 0
سيرم مرجعى سلبي لمرض الرعام في الخيول 10 مشخص Hyperimmune antisera (negative) against Burkholderia mallei Lyophilized. - 1ml/container- عبوة 2 0
سيرم مرجعى إيجابى قوي لمرض الرعام في الخيول 10 مشخص Hyperimmune antisera (strong) against Burkholderia mallei Lyophilized. - 1ml/container- عبوة 3 0
سيرم مرجعى إيجابى قوى لمرض خناق الخيل في الخيول 5 مشخص Hyperimmune antisera (strong) against Strept equi Lyophilized. - 1ml/container- عبوة 4 0
سيرم مرجعى لمرض إيجابى ضعيف خناق الخيل في الخيول 5 مشخص Hyperimmune antisera (weak) against Strept equi Lyophilized. - 1ml/container- عبوة 5 0

5 بند

جدول 35 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعى سلبي لمرض خناق الخيل في الخيول 5 مشخص Hyperimmune antisera (negative) against Strept equi Lyophilized. - 1ml/container- عبوة 1 0
سيرم مرجعي لطاعون المجترات لاختبار التعادل المصلي SNT 1 مل 5 مشخص سيرم مرجعي لطاعون المجترات لاختبار التعادل المصلي SNT 1 مل Standard reference antisera for PPR virus neutralization test: - (lyophilized 1 ml) عبوة 2 0
سيرم مرجعي مضاد للبروسيلا النوع s 8 مشخص سيرم مرجعي مضاد للبروسيلا النوع (S) Unabsorped hyperimmune anti-S-Brucella polyclonal serum: - Lyophilized. - 1ml/container عبوة 3 0
سيرم مرجعي مضاد للبروسيلا النوع R 8 مشخص سيرم مرجعي مضاد للبروسيلا النوع (R) Unabsorped hyperimmune anti-R-Brucella polyclonal serum: - Lyophilized. - 1ml/container عبوة 4 0
سيرم مرجعي أحادي مضاد للبروسيلا النوع A 8 مشخص سيرم مرجعي أحادي مضاد للبروسيلا النوع (A) Anti- A monospecific sera for brucella: - Lyophilized. - 1ml/container عبوة 5 0

5 بند

جدول 36 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي أحادي للبروسيلا النوع M 8 مشخص سيرم مرجعي أحادي للبروسيلا النوع (M) Anti- M monospecific sera for brucella: - Lyophilized. - 1ml/container عبوة 1 0
سيرم مرجعي للمايكوبلازما كابرينموني 8 مشخص سيرم مرجعي للمايكوبلازما كابرينموني Hyperimmune antisera against Mycoplasma capricolum subsp. Capripneumoniae - Lyophilized. - 1ml/container عبوة 2 0
سيرم مرجعي للمايكوبلازما كابريكولوم 8 مشخص سيرم مرجعي للمايكوبلازما كابريكولوم Hyperimmune antisera against Mycoplasma capricolum subsp. capricolum: ة- Lyophilized. - 1ml/container عبوة 3 0
سيرم مرجعي للمايكوبلازما كابري 2 مشخص سيرم مرجعي للمايكوبلازما كابري Hyperimmune antisera against Mycoplasma mycoides subsp. capri: - Lyophilized.- 1ml/container عبوة 4 0
سيرم مرجعي للمايكوبلازما أوفينموني 2 مشخص سيرم مرجعي للمايكوبلازما أوفينموني Hyperimmune antisera against Mycoplasma ovipneumoniae: - Lyophilized. - 1ml/container عبوة 5 0

5 بند

جدول 37 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي للمايكوبلازما أجالاكسي 2 مشخص سيرم مرجعي للمايكوبلازما أجالاكسي Hyperimmune antisera against Mycoplasma agalactiae: - Lyophilized. - 1ml/container. عبوة 1 0
سيرم مرجعي للمايكوبلازما مايكويديس 2 مشخص سيرم مرجعي للمايكوبلازما مايكويديس Hyperimmune antisera against Mycoplasma mycoides subsp. Mycoides: - Lyophilized. - 1ml/container عبوة 2 0
سيرم مرجعى للكلاميديا ابورتس 10 مشخص Hyperimmune antisera against Chlamydia abortus Lyophilized. - 1ml/container- عبوة 3 0
سيرم مرجعى إيجابى قوى للبروسيلا المالطية 10 مشخص Hyperimmune antisera (Strong) against Brucella abortus Lyophilized. - 1ml/container- عبوة 4 0
سيرم مرجعى سلبى للبروسيلا المالطية 10 مشخص Hyperimmune antisera (negative) against Brucella abortus Lyophilized. - 1ml/container- عبوة 5 0

5 بند

جدول 38 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعى إيجابى ضعيف للبروسيلا المالطية 10 مشخص Hyperimmune antisera (weak) against Brucella abortus Lyophilized. - 1ml/container- عبوة 1 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 5 ان 1 25 مشخص Reference HI Antiserum for Avian Influenza virus type H5N1 Lyophilized, Fully identified (including Antibody concentration) حبة 2 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 5 ان 2 3 مشخص Reference HI Antiserum for Avian Influenza type H5N1 Non-infectious. Lyophilized, Fully identified (including virus concentration) حبة 3 0
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة انفلونزا الطيور نوع اتش 5 إن 8 3 مشخص Reference HI Antiserum for Avian Influenza virus type H5N8Lyophilized, Fully identified (including Antibody concentration) عبوة 4 0
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة انفلونزا الطيور نوع اتش 5 إن 6 3 مشخص Reference HI Antiserum for Avian Influenza virus type H5N6Lyophilized, Fully identified (including Antibody concentration) عبوة 5 0

5 بند

جدول 39 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة انفلونزا الطيور نوع اتش 9 إن 2 3 مشخص Reference HI Antiserum for Avian Influenza virus type H9N2 Lyophilized, Fully identified (including Antibody concentration) عبوة 1 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 7 ان1 3 مشخص Reference HI Antiserum for Avian Influenza virus type H7N1 Lyophilized, Fully identified (including Antibody concentration) عبوة 2 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 7 ان2 3 مشخص Reference HI Antiserum for Avian Influenza virus type H7N2 Lyophilized, Fully identified (including Antibody concentration) عبوة 3 0
سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا 5 مشخص سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا Reference HI Antiserum for Lentogenic (LaSota ) Strain Newcastle disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 4 0
سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية 5 مشخص سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية Reference HI Antiserum for Mesogenic and velogenic Newcastle disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 5 0

5 بند

جدول 40 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي مانع للتلازن الدموي للعترة ماسوشيتي M41 لمرض التهاب الشعب الهوائية في الدجاج 3 مشخص سيرم مرجعي مانع للتلازن الدموي للعترة ماسوشيتي (M41) لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV Mass.(M41) strain disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 1 0
سيرم مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية 3 مشخص سيرم مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية Reference Antiserum for Infectious Bursal Disease virus Virulent strain (Interfield 2512 strain) Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
سيرم مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج 3 مشخص سيرم مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج Reference AGID Antiserum for Mareks disease virus in chicken. Lyophilized, Fully identified (including Antibody concentration) عبوة 3 0
سيرم مرجعي مانع للتلازن الدموي للعترة D274 لمرض التهاب الشعب الهوائية في الدجاج 3 مشخص سيرم مرجعي مانع للتلازن الدموي للعترة D274 لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV D274 strain disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 4 0
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج 3 مشخص سيرم مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV QX (D388) strain disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 5 0

5 بند

جدول 41 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي مانع للتلازن الدموي للعترة 793B 4 91 CR88 لمرض التهاب الشعب الهوائية في الدجاج 3 مشخص سيرم مرجعي مانع للتلازن الدموي للعترة 793B (4/91, CR88) لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV 793B (4/91, CR88) strain virus Lyophilized, Fully identified (including Antibody concentration) عبوة 1 0
طقم rtPCR للكشف عن البروسيلا أبورتس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1500 مشخص Real Time PCR kit FOR detection of Brucella abortus compatible with Roche, ABI and Biorad systems• Kit with reagents for the quantitative detection of Brucella abortus DNA. It contains: • specific primer/probe mix .- Positive control template., 100 tests RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data إختبار 2 0
طقم rtPCR للكشف عن البروسيلا ميليتنسيس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1500 مشخص Real Time PCR kit FOR detection of Brucella miletensis compatible with Roche, ABI and Biorad systems• Kit with reagents for the quantitative detection of Brucella miletensis DNA. It contains: • specific primer/probe mix.- Positive control template., 100 tests RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data ( يتوافق مع اجهزة روش وأي بي أي وبيوراد ) إختبار 3 0
طقم rtPCR للمايكوباكتيريوم باراتيوبركيولوسيس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1500 مشخص Real Time PCR kit FOR detection of Mycobacterium pratuberculosis compatible with ABI and Biorad systems.• Kit with reagents for the detection of Mycobacterium paratuberculosis.•It contains: • specific primer/probe mix.- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data ( يتوافق مع اجهزة روش وأي بي أي وبيوراد ) إختبار 4 0
طقم rtPCR لمرض الحمى المجهولة يتوافق مع اجهزة روش وأي بي أي وبيوراد 2500 مشخص Real Time PCR kit for detection of Q-fever compatible with ABI and Biorad systems.• Kit with reagents for the detection of Coxiella burnetii. • It contains: • specific primer/probe mix (150 reactions).- Positive control template RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data ( يتوافق مع اجهزة روش وأي بي أي وبيوراد ) إختبار 5 0

5 بند

جدول 42 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCR للكشف عن مرض الرعام في الفصيلة الخيلية يتوافق مع اجهزة روش وأي بي أي وبيوراد 500 مشخص rtPCR kit for detection of glanders in equines: It includes all needed components and contains: TagMan fast advanced master., 100 tests - IPC primers and probe. - TagMan oligonucleotide probes. - Oligonucleotide sense and antisense primers. B. mallei: fliP forw (5´-3´): CCC ATT GGC CCT ATC GAA G -- flip rev (5´-3´): GCC CGA CGA GCA CCT GAT T -- flip probe: FAM-CAG GTC AAC GAG CTT CAC GCG GAT C-TAMRA B. pseudomallei complex: aroA forw (5´-3´): CCG CTC GTG AAG GCG AAG -- aroA rev (5´-3´): CGC CAT CAG CTT GAT CGT GA -- aroA probe: FAM -CGA GCG TCG TCG AGA TCG-TAMRA -- Autoclaved ultrapure water. - Controls and any other required items for the test. اختبار 1 0
طقم rtPCR للكشف عن مايكوباكتيريوم بوفس في حيوانات المزرعة يتوافق مع أجهزة شركة Roche وabi 200 مشخص Real time PCR kit FOR detection of Mycobacterium bovis in animals compatible with Roche, ABI and Biorad systems. It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix., 100 testsSupply with control certificate and validation report data (يتوافق مع اجهزة روش وأي بي أي وبيوراد) إختبار 2 0
طقم rtpcr لمرض حمى الوادي المتصدع يتوافق مع أجهزة شركة ABI 1500 مشخص RVF Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Rift Valley Fever virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data ( يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 3 0
طقم rtPCR لفيروس مرض التهاب الشرايين في الخيول يتوافق مع اجهزة شركة روش ABI BioRad 1500 مشخص EVA Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Equine Viral Arterities virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 4 0
طقم rtPCR لفيروس مرض انفلونزا الطيور النوع أ ام 2 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 10000 مشخص Avian Influenza ( Matrix gene) Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A Matrix gene contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 5 0

5 بند

جدول 43 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش 9 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 10000 مشخص Avian Influenza subtype H9 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H9 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 1 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش 5 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 15000 مشخص Avian Influenza subtype H5 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtypeH5 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 2 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان 1 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 10000 مشخص Avian Influenza subtype N1 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N1 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 3 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان6 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 1500 مشخص Avian Influenza subtype N6 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N6 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 4 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان8 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 5000 مشخص Avian Influenza subtype N8 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N8 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 5 0

5 بند

جدول 44 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان2 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 5000 مشخص Avian Influenza subtype N2 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N2 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 1 0
طقم rtPCR خاص بفيروس الليكوزس في الطيور الجين العام يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس الليكوزس في الطيور الجين العام يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit for detection of Avian Leukosisvirus (genes for Subtypes A, B, E & J) which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample.Multiplex PCR reagent; could differentiate between subtypes.Quantitative & qualitative.High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data إختبار 2 0
طقم rtPCR خاص بفيروس النيمو في الطيور يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس النيمو في الطيور يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit for detection of Avian Pneumovirus which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample.Quantitative & qualitative.High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data إختبار 3 0
طقم rtPCR خاص بفيروس الأدينو في الطيور يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس الأدينو في الطيور يتوافق مع اجهزة شركة روش وأجهزة شركة ABI One step rtPCR kit for detection of Avian Adenovirus (FAV-1) which include:Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample.Quantitative & qualitative. High sensitivity and specificityInternationally validated.Supply with control certificate and validation report data إختبار 4 0
طقم rtPCR خاص بفيروس تدني انتاج البيض في الطيور EDSيتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس تدني انتاج البيض في الطيور EDSيتوافق مع اجهزة شركة روش وأجهزة شركة ABI One step rtPCR kit for detection of Egg Drop Syndrome which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample. Quantitative & qualitative. High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data. إختبار 5 0

5 بند

جدول 45 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCR خاص بفيروس التهاب الحنجرة والقصبة الهوائية في الطيور يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس التهاب الحنجرة والقصبة الهوائية في الطيور يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit for detection of Infectious Laryngeotracheitis (ILTV) which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample. Quantitative & qualitative. High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data إختبار 1 0
طقم rtPCR خاص بفيروس الريو في الطيور يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس الريو في الطيور يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit for detection of Reovirus which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample. Quantitative & qualitative. High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data. إختبار 2 0
طقم rtPCR خاص بفيروس أنيميا الطيور يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس أنيميا الطيور يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit for detection of Chicken Anemia Virus (CAV) which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample. Quantitative qualitative. High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data. إختبار 3 0
طقم rtPCR خاص بفيروس النزيف الدموي المعدي في الأرانب يتوافق مع اجهزة شركة روش وأجهزة شركة ABI و BIORAD 200 مشخص طقم rtPCR خاص بفيروس النزيف الدموي المعدي في الأرانب يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit for detection of Infectious Hemorrhagic Septicemia Virus in Rabbits (RHSV) which include: Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample. Quantitative & qualitative. High sensitivity and specificity Internationally validated. Supply with control certificate and validation report data. إختبار 4 0
طقم rtPCR لفيروس مرض هيربس 1في الخيول 1250 مشخص Equine Herps1 Real-Time PCR Detection kit: Real-time qPCR kit for detection of Equine Herps1 virus contains all reagents and controls:(contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 5 0

5 بند

جدول 46 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش 5 ان 2 1500 مشخص Avian Influenza subtype H5N6 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H5N6 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد) اختبار 1 0
طقم rtPCRلفيروس مرض الجمبور يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 3000 مشخص IBDV Screening Real-Time RT-PCR detection kit: One-step real-time qPCR kit for detection of Infectius Bursal Disease virus ,contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 2 0
طقم rtPCRلفيروس مرض ا التهاب الشعب الهوائية عترة OX يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 2000 مشخص IBV QX Strain Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of QX Strain of Infectioua bronchitis virus ,contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 3 0
طقم rtPCRلفيروس مرض التهاب الشعب الهوائية عترة مغايرة يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 2000 مشخص IBV Variant Strain Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of variant strain of Infectioua bronchitis virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 4 0
طقم rtPCRلفيروس مرض التهاب الشعب الهوائية جين عام يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 5000 مشخص IBV (universal gen) Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Infectioua bronchitis virus (unuversal gen) contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 5 0

5 بند

جدول 47 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCR لفيروس مرض الميرك يتوافق مع اجهزة شركة روش و ABI و BIORAD 500 مشخص طقم rtPCR لفيروس مرض الميرك يتوافق مع اجهزة شركة روش و ABI و BIORAD One step rtPCR kit FOR detection of Mareks disease virus include:Lyophilized mix of primers and probes for a total of 96 reactions Contains lyophilized primer/probe mix for 96 reactions, lyophilized internal control set mix & Positive control lyophilized sample.Could differentiate between field and vaccinal strainQuantitative & qualitative.High sensitivity and specificity Internationally validated.Supply with control certificate and validation report data إختبار 1 0
طقم اليزا للكشف عن الأجسام المضادة لمرض طفيل الثايليريا 2500 مشخص Indirect ELISA for detection of antibodies againstTheileria annulata. Detects antibodies against the parasite in serum and plasma of ruminants High sensitivity and specificity. Internationally validated. 2 Plates/ kit. إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لمرض إسهال الأبقار الفيروسي 10000 مشخص IndirectELISA for detection of antibodies against BVD in cattle. The kit is able to detect specific BTV antibody against BVDV in bovine serum, plasma or milk samples. High sensitivity and specificity Internationally validated. 5 plates / Kit إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض جون في الحيوانات 20000 مشخص IndirectELISA for detection of antibodies against M. paratuberculosis in animals. Able to detect antibodies in serum and plasma of ruminant (ovine, caprine, bovine and camel). High sensitivity and specificity. Internationally validated. 5 plates / Kit (format 12*8 –well strip).(طقم/5 أطباق) إختبار 4 0
طقم اليزا للكشف عن الكلوستريديوم بيرفرنجنز وسمومها الفا وبيتا وابسلون فى الحيوانات طقم 96 اختبار 2880 مشخص ELISA for detection of Cl. Perfringens and its toxins (alpha, beta and epsilon) in intestinal contents of animals. Able to detect Cl. Perfringens cells and its toxins in intestinal contents of animals. High sensitivity and specificity. Internationally validated. 2 plates / Kit (96 tests). إختبار 5 0

5 بند

جدول 48 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن انتجين فيروسات روتا وكورونا والاي كولاى والكربتوسبوريديم فى روث الابقار 2000 مشخص Immuno-capture ELISA for detection of Rota and Corona viruses, E. coli and Cryptosporidium in bovine Immuno-capture ELISA that is able to detect Rota and Corona viruses, E. coli and Cryptosporidium in bovine (in one strip). Internationally validated. One plate / kit.(طقم/96 اختبار) إختبار 1 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض الهيربس النوع 1 في الأبقار 2000 مشخص Indirect ELISA for detection of antibodies against Herpsvirus 1 in cattle (IBR). Able to detect antibodies in cattle serum against Bovine Herpsvirus -1 (BoHV-1) High sensitivity and specificity Internationally validated. 5 plates / Kit. إختبار 2 0
طقم اليزا للكشف عن الاجسام المضادة لمرض التهاب الشرايين الفيروسي في الخيول 5000 مشخص Elisa Kit for the detection of anti-EVA (Equine Viral Arteritis) antibodies in horse serum and plasma. Detects Antibody for Equine Viral Arteritisin serum and plasma of horses. 5 plates. High sensitivity and specificity. • Internationally validated. إختبار 3 0
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا فى حليب الحيوانات 2500 مشخص Indirect Elisa kit for detection of antibodies against Brucella in animal milk. • For the detection of Brucella antibodies inbovine, ovine and caprine milk. • 5 plates kit. • detection of antibody in individual milk sample or in bulk milk • high sensitivity and specificity • Internationally validated. إختبار 4 0
طقم إليزا للكشف عن مرض البقعه الحلقية النخرية في الخوخ 1500 مشخص ELISA complete kit for the detection of Prune Necrotic Ring spot Virus (PNRV). Kit contains ≤ 500 tests. kit contains positive & negative controls. إختبار 5 0

5 بند

جدول 49 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع A 2500 مشخص طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع أ. Indirect ELISA for detection of antibodiesagainst influenza type A the kit is able to detect antibodies in serum of birds (multispecies) Quantitative.High sensitivity and specificity Internationally validated.5 plates…12×8 –well -strip.Supply with control certificate and validation report data إختبار 1 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع H5 1920 مشخص طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع (H5) . Indirect ELISA for detection of antibodies against influenza type A subtype H5 the kit is able to detect antibodies in serum of birds (multispecies) Quantitative. High sensitivity and specificity Internationally validated. 2 plates…12×8 –well -strip. Supply with control certificate and validation report data. إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع H9 1920 مشخص طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع (H9) .Indirect ELISA for detection of antibodies against influenza type A subtype H9 the kit is able to detect antibodies in serum of birds (multispecies) Quantitative. High sensitivity and specificity Internationally validated. 2 plates…12×8 –well strip Supply with control certificate and validation report data. إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع H7 960 مشخص طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع (H7). Indirect ELISA for detection of antibodies against influenza A subtype H7 the kit is able to detect antibodies in serum of birds (multispecies) Quantitative. High sensitivity and specificity Internationally validated. 2 plates…12×8 –well strip Supply with control certificate and validation report data إختبار 4 0
طقم اليزا للكشف عن الاجسام المضادة لمرض النيوكاسل 2000 مشخص طقم اليزا للكشف عن الاجسام المضادة لمرض النيوكاسل ELISA for detection of antibodies against NDV.Indirect ELISA for detecting antibodies against Newcastle disease in poultry(multispecies). Quantitative. 5 plates…12×8 –well strip. High sensitivity and specificity. Supply with control certificate and validation report data. إختبار 5 0

5 بند

جدول 50 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لمرض الالتهاب الشعب الهوائية المعدي في الطيور 2000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الالتهاب الشعب الهوائية المعدي في الطيورIndirect ELISA for sero-diagnosis of Infectious bronchitis in poultry (multispecies). The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated.Supply with control certificate and validation report data. إختبار 1 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الجمبورو المعدي في الدجاج 2000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الجمبورو المعدي في الدجاجIndirect ELISA for sero-diagnosis of Infectious bursal disease in chickenThe kit is able to detect antibody in bird's serum Quantitative.5 plates…12×8 –well stripHigh sensitivity and specificity.Internationally validated.Supply with control certificate and validation report data. إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لمرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 2000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور Indirect ELISA kit for detection of Antibody against infectious Laryngeotracheitis (ILT) virus. The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated. Supply with control certificate and validation report data. إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الشلل الرعاش الوبائي في الطيور 2000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الشلل الرعاش الوبائي في الطيور Indirect ELISA kit for detection of Abs against Avian Encephalomyeilitis virus. The kit is able to detect antibody in bird's serum. Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated.Supply with control certificate and validation report data. إختبار 4 0
طقم اليزا للكشف عن الأجسام المضاده لمرض الريو في الطيور 2000 مشخص طقم اليزا للكشف عن الأجسام المضاده لمرض الريو في الطيور Indirect ELISA kit for detection of antibodies against Reovirus infection in birds. The kit is able to detect antibody in birds serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated. Supply with control certificate and validation report data. إختبار 5 0

5 بند

جدول 51 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لمرض الأدينوفيرس فى الطيور 2000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الأدينوفيرس فى الطيور Indirect ELISA kit for Antibody Detection against (FADV) Group 1 Avian Adenovirus The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated.Supply with control certificate and validation report data إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة لمرض تدني البيض في الطيور 2000 مشخص طقم اليزا للكشف عن الاجسام المضادة لمرض تدني البيض في الطيور Indirect ELISA for detection of antibodies against Egg Drop SyndromeDetects antibodies against EDS in chicken.Quantitative. 5 plates.High sensitivity and specificity Internationally validated. إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس في الطيور 960 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس في الطيورIndirect ELIAS kit for detection of antibodies against Avian Leukosis. Detects antibody against ALV subgroup A,B,C,E in serum sample. Quantitative. 5 plates…12×8 –well stripHigh sensitivity and specificity. Internationally validated. Supply with control certificate and validation report data إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس نوع J في الطيور 960 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس نوع J في الطيور Indirect ELISA kit for detection of Avian Leukosis virus antibody subgroup J. detect antibody against subgroup J in serum sample. Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validatedSupply with control certificate and validation report data إختبار 4 0
طقم اليزا للكشف عن أنتجن P27 مرض الليكوزس في الطيور 960 مشخص طقم اليزا للكشف عن أنتجن P27 مرض الليكوزس في الطيور Direct ELISA kit for detection of Avian Leukosis virus Antigen P27. Able to detect antigen in cloacal swab, albumin, and serum sample.Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validatedSupply with control certificate and validation report data. إختبار 5 0

5 بند

جدول 52 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا أوفيس في الضأن 3840 مشخص Indirect ELISA for detection of antibodies against Brucella ovis in sheep. • Detection of antibodies against Brucella ovis infection in sheep serum • High sensitivity and specificity • Internationally validated • 2 plates (طقم/طبقين) إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا مليتنسيس في الضأن والماعز طقم 5 أطباق 12000 مشخص Indirect ELISA for detection of antibodies against B. mellitensis in small ruminants. • Elisa for detection of antibodies against Br. mellitensis in sheep and goat serum • High sensitivity and specificity. • Internationally validated. • 5 plates إختبار 2 0
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا ابورتس فى الابقار 7200 مشخص Indirect ELISA for detection of antibodies against Brucella abortus in cattle • Elisa for detection of antibodies against B. abortus in cattle serum and plasma • High sensitivity and specificity. • Internationally validated.• 5 plates(طقم/5 أطباق) إختبار 3 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة للبروسيلا مليتنسيس في الحيوانات 3840 مشخص . Competitive ELISA for detection of antibodies against B. mellitensis in animals.• A competitive elisa for detection of antibody against B. mellitensis in animals.• High sensitivity and specificity. • Internationally validated.• 2 plates(طقم/طبقين) إختبار 4 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لحمى النزلة الخبيثة في الابقار 480 مشخص طقم اليزا تنافسية للكشف عن الاجسام المضادة لحمى االنزلة الخبيثة في الابقار. Competitive ELISA for detection of antibodies against Malignant Catarrhal Fever disease (MCFV) in cattle. detect antibodies in serum of cattle, wild and domestic ruminants High sensitivity and specificity. Internationally validated. 2 plates إختبار 5 0

5 بند

جدول 53 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لمرض الحمى القلاعية ضد البروتين غير البنائي 3ABCفي الأبقار والأغنام ويفرق بين المحصن والمصاب طبيعيا 25000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض الحمى القلاعية ضد البروتين غير البنائي (3ABC) في الأبقار والأغنام ويفرق بين المحصن والمصاب طبيعيا. Indirect ELISA kit for detection of antibodies against Nonstructural proteins of FMD (3ABC) and differentiate between naturally infected (+3ABC) and vaccinated animals Detects antibodies against nonstructural proteins (3ABC) of FMD virus in serum or plasma from bovine and ovine Differentiate between naturally infected and vaccinated animals (bovine, ovine).High sensitivity and specificity Internationally validated.5 plates إختبار 1 0
كاشف اختبار الروز بنقال 100 مل عبوة 60 مشخص Rose Bengal test reagent Volume 100 ml. A suspension of Brucella abortus (Weybridge 99 strain) inactivated by heat and phenol and colored with rose bengal stain in an acidified buffer. Gives a positive reaction with a dilution at 1:45 of the second international anti-Brucella abortus serum (OIEISS), while with a dilution at 1:55 it should be negative. Internationally validated. عبوة 2 0
طقم كاشف مايسيك v2 8 مشخص MiSeq Reagent Kit v2 - 500-Cycle (Box1, Box2) MiSeq sequencing reagents in pre-filled, ready-to-use. • Maximum Output: 7.5 -8.5 Gb. • Maximum Reads per Run: Up to 15 million. • Size (cycles): 500. • Nucleic Acid Type: DNA –RNA طقم 3 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس الحمى القلاعية 40 مشخص FMD Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 4 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن البروسيلا ابورتس 24 اختبار طقم 30 مشخص Pockit Central PCR PREMIX REAGENT PCR for detection of Brucella abortus, High sensitivity and specificity. Kit/24 reaction طقم 5 0

5 بند

جدول 54 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
كاشف بريمكس بي سي ار بوكيت المركزي للكشف انفلونزا الطيور النوع اتش 5 25 مشخص Influenza H5 Premix reagent Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. (24 اختبار/طقم) طقم 1 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف انفلونزا الطيور ااتش 9 25 مشخص Influenza H9 Premix reagent Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. (24 اختبار/طقم) طقم 2 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس حمى الوادي المتصدع ال 25 مشخص RVF Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 3 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس التهاب الجلد العقدي 12 مشخص LSD Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 4 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف انفلونزا الطيور النوع أ 75 مشخص Influenza A Premix reagent Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. (24 اختبار/طقم) طقم 5 0

5 بند

جدول 55 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس اللسان الازرق 50 مشخص Blue tongue Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. طقم 1 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس طاعون المجترات الصغيرة 50 مشخص PPR Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 2 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس ميرس كورونا اب أي جين 10 مشخص MERS-COV(upE) Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 3 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن البروسيلا مليتنسيس 24 اختبار طقم 30 مشخص Pockit Central PCR PREMIX REAGENT PCR for detection of Brucella melitenses, High sensitivity and specificity, Kit/24 reaction طقم 4 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن بكتيريا السالمونيلا 24 اختبار طقم 25 مشخص Pockit Central PCR PREMIX REAGENT PCR for detection of Salmonella spp, High sensitivity and specificity, Kit/24 reaction طقم 5 0

5 بند

جدول 56 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم ناسخ للحمض النووي للتحليل الجيني 100 تفاعل 2500 مشخص Transcriptor first strand cDNA synthesis kit • Transcriptor Reverse Transcriptase (20 U/µL).• Transcriptor RT Reaction Buffer, 5x concentrated/ (NOT LESS THAN 2X CONC.)• Protector RNase Inhibitor (40 U/µL).• dNTP Mix(10- m M EACH), PCR Grade• Anchored Oligo (dT)15-18 (50 µM) Primer• Random Hexamer (600µM) Primer• Control RNA template• forward primer (10µM)• reverse primer (10µM)• Water, PCR grade,100 Reactions إختبار 1 0
طقم تعادل الألوان لأنظمة لايت سيكلور 7 مشخص LightCycler Color Compensation set طقم 2 0
طقم للمعايرة الطيفية يتوافق مع جهاز ABI 7500 10 مشخص ABI 7500 7500 Real-Time PCR Systems Spectral Calibration Kit I Includes one background plate, seven spectral calibration plates with FAM™/SYBR™ Green I, VIC™/JOE™, and NED™/TAMRA™/ROX™ dye standards, and one ROI calibration plate.7500 Real-Time PCR Systems Spectral Calibration Kit II طقم 3 0
طقم استخلاص الحمض النووي يتوافق مع جهاز ماجنابيور 24 مع كامل ملحقاته 40 مشخص MagNA Pure 24 Total NA Isolation Kit contains prefilled and ready-to-use reagent cassettes and magnetic glass particles (MGPs) vials, for use with the MagNA Pure 24 System,and all other contents and accessories needed to perfrm the test, 96 isolations. طقم 4 0
طقم استخلاص الحمض النووي من العينات البرازية 3000 مشخص DNA extraction stool kit.• For 50 DNA preps: 50 Mini Spin Columns, Proteinase K, Inhibit EX tablets, Buffers, Collection Tubes (2 ml). إختبار 5 0

5 بند

جدول 57 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم استخلاص أر إن ايه للحامض النووي الفيروسي يدويا 3000 مشخص Viral RNA Isolation kit for rapid and simple purification of viral RNA of the highest integrity from a variety of sources,with fast spin-column procedures ,96 reactions إختبار 1 0
طقم استخلاص الحمض النووي من عينات الانسجة والدم 3000 مشخص طقم استخلاص الحمض النووي من عينات الانسجة والدم DNA extraction blood and Tissue Kit. For 4 x 96 DNA minipreps: 4 X 96 well Plates, Proteinase K, Buffers, S-Blocks, AirPore Tape Sheets, Collection Microtubes (1.2 ml), Elution Microtubes RS, Caps, 96-Well Plate Registers إختبار 2 0
طقم استخلاص الحمض النووي يتوافق مع أجهزة روش مجنابيور 96 مع كامل ملحقات اجراء التفاعل من اطباق ومحاليل وخلافه 11520 مشخص MagNa pure 96 nucleic acid extraction kit (576 RXN) with all accessories needed to complete the test (Processing Cartridge compatible with MagNA pure 96,Sealing Foil compatible with MagNA pure 96, Internal kit compatible with MagNA pure 96, Control tube compatible with MagNA pure 96, Filter tips (1000 ul) compatible with MagNA pure 96 ). اختبار 3 0
طقم استخلاص الحمض النووي العام يتوافق مع جهاز استخلاص كنغ فيشر 96 يحتوي على جميع ملحقات تشغيل النظام كينج فيشر فليكس 12000 مشخص Core RNA/DNA Extraction Kit compatible with King Fisher 96, Nucleic acid extraction device • Universal Pathogen kit, for Bacteria, Virus and Parasites from different samples including feces. • All required consumables should be included. • Should be provided with 100% isopropanol and 100% ethanol bottles 480 reactions. Including all consumables for 96 extraction instrument. اختبار 4 0
طقم استخلاص الحمض النووي العام يتوافق مع جهاز استخلاص كنغ فيشر 24 يحتوي على جميع ملحقات تشغيل النظام كينج فيشر دو 4800 مشخص Core RNA/DNA Extraction Kit compatible with King Fisher 24 Nucleic acid extraction device • Universal Pathogen kit, for Bacteria, Virus and Parasites from different samples including feces. • All required consumables should be included. • Should be provided with 100% isopropanol and 100% ethanol bottles 480 reactions. Including all consumables for 24 extraction instrument. اختبار 5 0

5 بند

جدول 58 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم فايتيك 2 للتعرف على البكتيريا موجبة جرام عبوة 20 30 مشخص طقم فايتيك 2 للتعرف على البكتيريا موجبة جرام (عبوة / 20) VITEK2 ID FOR GP Bacteria (GP cards) طقم 1 0
طقم فايتيك 2 للتعرف على البكتيريا سالبة جرام عبوة 20 60 مشخص طقم فايتيك 2 للتعرف على البكتيريا سالبة جرام (عبوة / 20) VITEK2 ID FOR GN Bacteria (GN cards) طقم 2 0
طقم فايتيك 2 للتعرف على البكتيريا اللاهوائية عبوة 20 12 مشخص طقم فايتيك 2 للتعرف على البكتيريا اللاهوائية (عبوة / 20) Vitek 2 ID For anaerobic bacteria (ANC cards طقم 3 0
طقم فايتيك للتعرف على بكتيريا الباسيلس 12 مشخص طقم فايتيك للتعرف على بكتيريا الباسيلس (عبوة / 20) VITEK 2 Bacillus identification card (BCL cards) طقم 4 0
طقم فايتيك للتعرف على البكتيريا غير المخمرة عبوة 20 12 مشخص طقم فايتيك للتعرف على البكتيريا غير المخمرة (عبوة / 20) VITEK2 bacterial identification card طقم 5 0

5 بند

جدول 59 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم ضابط فيكس FC 3 مشخص PHIX CONTROL KIT (v3) PhiX Control is a ready-to-use control library for sequencing runs. طقم 1 0
طقم تنقية الحامض النووي 4 مشخص Ampure XP Magntic purification kit – 5ml. Used for PCR Purification, NGS Clean-up, PCR clean-up. Liquid. طقم 2 0
طقم تحليل الحمض النووي دي ان ايه عالي الحساسية 5 مشخص Agilent High Sensitivity DNA Kit • Agilent High Sensitivity DNA Chips- 10 High Sensitivity DNA Chips - 1 Electrode Cleaner - Syringe Kit - 1 Syringe • Agilent High Sensitivity DNA Reagents (reorder-no 5067-4627) - yellow) High Sensitivity DNA Ladder - (green) High Sensitivity DNA Markers 35/10380 bp (4 vials) - (blue) High Sensitivity DNA Dye Concentrate 1 (1 vial) -( red) High Sensitivity DNA Gel Matrix (2 vials) - 2 Spin Filters طقم 3 0
طقم الاكيوبت 5 مشخص Qubit dsDNA HS Assay Kit عدد 4 0
طقم تصنيع الخيط الثاني للحمض النووي 1 مشخص Double-Stranded cDNA Synthesis Kit (10 reaction) عبوة 5 0

5 بند

جدول 60 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم تصنيع الحمض النووي دي ان إي High Fidelity 5 مشخص Platinum Taq DNA Polymerase High Fidelity 1 x 20 µL Platinum Taq DNA Polymerase High Fidelity (5 U/µL) • 1 x 1.25 mL 10X High Fidelity Buffer [600 mM Tris-SO4 (pH 8.9), 180 mM (NH4)2SO4] • 1 x 1 mL 50 mM MgSO4 Store at -10°C to -30°C. The number of 100 tests. طقم 1 0
طقم السلم لقياس حجم الدنا G 2 مشخص GeneRuler 100bp DNA ladder, ready for use GeneRuler 100 bp DNA Ladder is recommended for sizing and approximate quantification of a double-stranded DNA in the range of 100 bp to 1,000 bp on agarose or polyacrylamide gels. The DNA ladder consists of 10 DNA fragments and is provided with 6X TriTrack DNA Loading Dye. طقم 2 0
طقم استخلاص الدنا من الجل 1 مشخص QIAquick Gel Extraction Kit QIAquick Gel Extraction Kit (1000) For gel extraction or cleanup of 1000 reactions: 1000 QIAquick Spin Columns, Buffers, Collection Tubes (2 ml) طقم 3 0
طقم التخلص من المادة الوراثية 1 مشخص DNA- free DNases kit (life technologies) (gDNA DEPLETION) (gDNA) طقم 4 0
طقم استخلاص الحامض النووي خاص بجهاز تفاعل البلمرة المتسلسل المتنقل 400 مشخص Cartridge Set for Nucleic Acid Extraction Compatible with Pockit Central. Transfer Cartridge:24 test/package, Extraction Cartridge: contain all reagent for Nucleic Acid Extraction طقم 5 0

5 بند

جدول 61 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أطقم منظمة الصحة العالمية كاملة لاختبار تشخيص مقاومة البعوض البالغ للمبيدات 2 أنابيب Susceptibility test kit for adult mosquitoes (WHO/VBC/81.806) طقم 1 0
أطقم منظمة الصحة العالمية كاملة لاختبار التقييم الحيوي لمقاومة البعوض البالغ للمبيدات المستخدمة على الأسطح 2 أنابيب WHO test kits for adult mosquito bioassay on wall surfaces test kit (VBC/81.5) طقم 2 0
أطقم منظمة الصحة العالمية كاملة لاختبار تشخيص مقاومة يرقات البعوض للمبيدات 2 قوارير WHO test kits for monitoring insecticide resistance in mosquito larvae (WHO/VBC / 81.807) طفم 3 0
أطقم منظمة الصحة العالمية كاملة لاختبار تشخيص مقاومة يرقات البعوض لمثبطات النمو 2 قوارير WHO complete test kits for mosquitoes (Larvae resistance to development inhibitors) including one complete set of each insecticide and control- WHO/VBC/81.812 طقم 4 0
طقم تحليل تتابع التسلسل الوراثي للترقيم 8 مشخص Nextera XT Index Kit (96 Indexes, 96 Samples) طقم 5 0

5 بند

جدول 62 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل التوكسوبلازما يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 300 مشخص طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل التوكسوبلازما يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Toxoplasma spp. - Toxoplasma spp. specific primer/probe mix. -positive control template. -RNAse/DNAse free water. -Template preparation buffer The kit should be provided with the suitable qPCR mastermix. إختبار 1 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن الثايليريا ليستوكواردي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 300 مشخص طقم بي سي ار ذو الوقت الحقيقي للكشف عن الثايليريا ليستوكواردي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for Theileria lestoquardi. - Theileria lestoguardi specific primer/probe mix. - SPV positive control template. - RNAse/DNAse free water. - Template preparation buffer. The kit should be provided with the suitable qPCR mastermix. إختبار 2 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن تريبانوسوما ايفانساي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 300 مشخص طقم بي سي ار ذو الوقت الحقيقي للكشف عن تريبانوسوما ايفانساي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Trypanosoma evansi. -Trypanosoma evansi specific primer/probe mix. -SPV positive control template. -RNAse/DNAse free water Template preparation buffer The kit should be provided with the suitable qPCR mastermix. إختبار 3 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل البابيزيا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 300 مشخص طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل البابيزيا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Babesia spp. - Babesia spp specific primer/probe mix. - positive control template. - RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. إختبار 4 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل الانابلازما يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 300 مشخص طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيا الانابلازما يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Anaplasma spp. - Anaplasma spp. specific primer/probe mix -positive control template. - RNAse/DNAse free water.Template preparation buffer The kit should be provided with the suitable qPCR mastermix. إختبار 5 0

5 بند

جدول 63 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل الكوكسيديا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 300 مشخص طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل الكوكسيديا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Coccidia spp. -Coccidia spp. specific primer/probe mix. -positive control template. -RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. إختبار 1 0
طقم ملتيبلكس بي سي أر للكشف عن البروسيلا وتحديد أنواعها طقم 24 تفاعل 10 مشخص Multiplex conventional PCR for brucella spp. The kit allows detecting and differentiating the brucellae affecting farm animals: B.melitensis, B.abortus, B.suis and B.ovis and the RB51, B19 and Rev1 vaccines. Kit content: Mixture A ( specific primers for Brucella), Mixture B (enzyme mixture), Positive Control A1 – (C+ of Amplification B.Suis), Positive Control A2 (C+ of Amplification RB51), Positive Control A3 (C+ of Amplification Rev 1). Kit/24 reaction. طقم 2 0
طقم لعدد المجموعة المعوية تمبو 5 مشخص TEMPO KIT for EB count Compatible to TEMPO -TEMPO cards 2 x 24 -TEMPO culture medium 2 x 24 vials طقم 3 0
طقم فيداس للكشف عن الإي كولاي 2 مشخص VIDAS KIT for detection of E.coli 0157(ECPT) Compatible to VIDAS -        Positive control -       Negative control طقم فيداس للكشف عن الإي كولاي (0157) 60 اختبار طقم 4 0
طقم فيداس للتأكيد السيرولوجي للإي كولاي 2 مشخص طقم فيداس للتأكيد السيرولوجي للإي كولاي (0157) 60 اختبار VIDAS KIT for confirmation of E.coli 0157(ICE) Compatible to 60 اختبار VIDAS -       Positive control -       Negative control طقم 5 0

5 بند

جدول 64 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم مصلي متعدد عام لكشف عن السالمونيلا 2 مشخص طقم مصلي متعدد عام لكشف عن السالمونيلا Polyvalent Antiserum Consists of: -       Salmonella Polyvalent O Antiserum, A - I + Vi 3 ml/vial -       Salmonella Polyvalent O Antiserum, A – S 3 ml/vial -       Salmonella Polyvalent Antiserum H Phase 1 & 2 3 ml/vial Salmonella Polyvalent Antiserum H Phase 2, Factors 1, 2, 5, 6, 7, z63 ml/vial طقم 1 0
طقم تحديد النمط المصلي للسالمونيلا 1 مشخص طقم تحديد النمط المصلي للسالمونيلا Salmonella serotyping kit Somatic O Antiserum: -       Salmonella Somatic O Antiserum, Group B, Factor 4           3 ml/vial -       Salmonella Somatic O Antiserum, Group B, Factor 5           3 ml/vial -       Salmonella Somatic O Antiserum, Group C, Factor 6, 7           3 ml/vial -       Salmonella Somatic O Antiserum, Group C2, Factor 8             3 ml/vial -       Salmonella Somatic O Antiserum, Group D, Factor 9             3 ml/vial -       Salmonella Somatic O Antiserum, Group A,B,D Factor 12           3 ml/vial -       Salmonella Somatic O Antiserum, Group E Factor 3,10,15,19,34  3 ml/vial -       Salmonella Somatic O Antiserum, Group E2 Factor 15    3 ml/vial -       Salmonella Somatic O Antiserum, Group E4 Factor 19    3 ml/vial -       Salmonella Somatic O Antiserum, Group E3 Factor 34   3 ml/vial -       Salmonella Somatic O Antiserum, Group F Factor 11       3 ml/vial -       Salmonella Somatic O Antiserum, Group G Factor 13, 22, 23   3 ml/vial -       Salmonella Somatic O Antiserum, Group G1 Factor 22       3 ml/vial -       Salmonella Somatic O Antiserum, Group G2 Factor 23       3 ml/vial -       Salmonella Somatic O Antiserum, Group C3 Factor 20       3 ml/vial -       Salmonella Somatic O Antiserum, Group I Factor 16         3 ml/vial -       Salmonella Somatic O Antiserum, Group J Factor 17          3 ml/vial -       Salmonella Somatic O Antiserum, Group K Factor 18 1       3 ml/ vial -       Salmonella Somatic O Antiserum, Group L Factor 21           3 ml/vial -       Salmonella Somatic O Antiserum, Group M Factor 28          3 ml/vial -       Salmonella Somatic O Antiserum, Group N Factor 30      3 ml/vial -       Salmonella Somatic O Antiserum, Group O Factor 35     3 ml/vial -       Salmonella Somatic O Antiserum, Group P Factor 38       3 ml/vial -       Salmonella Somatic O Antiserum, Group Q Factor 39      3 ml/vial -       Salmonella Somatic O Antiserum, Group R Factor 40    3 ml/vial -       Salmonella Somatic O Antiserum, Group S Factor 41    3 ml/vial -       Salmonella Somatic O Antiserum, Factor 55                   3 ml/vial   Monovalent H Antiserum: -        Salmonella Monovalent H Antiserum, Factor a 3 ml/vial -        Salmonella Monovalent H Antiserum, Factor b 3 ml/vial -        Salmonella Monovalent H Antiserum, Factor c 3 ml/vial -        Salmonella Monovalent H Antiserum, Factor d 3 ml/vial -        Salmonella Monovalent H Antiserum, E Complex eh, enx, enz15 3 ml/vial -        Salmonella Monovalent H Antiserum, Factor eh              3 ml/vial -        Salmonella Monovalent H Antiserum, Factor enx          3 ml/vial -        Salmonella Monovalent H Antiserum, Factor enz15      3 ml/vial -        Salmonella Monovalent H Antiserum, Factor h             3 ml/vial -         Salmonella Monovalent H Antiserum, Factor z15         3 ml/vial -        Salmonella Monovalent H Antiserum, G Complex          3 ml/vial -        Salmonella Monovalent H Antiserum, Factor gm            3 ml/vial -        Salmonella Monovalent H Antiserum, Factor gp            3 ml/vial -        Salmonella Monovalent H Antiserum, Factor p                3 ml/vial -        Salmonella Monovalent H Antiserum, Factor u                3 ml/vial -        Salmonella Monovalent H Antiserum, Factor s                   3 ml/vial -        Salmonella Monovalent H Antiserum, Factor m               3 ml/vial -        Salmonella Monovalent H Antiserum, Factor t                 3 ml/vial -        Salmonella Monovalent H Antiserum, Factor f                   3 ml/vial -        Salmonella Monovalent H Antiserum, Factor q                  3 ml/vial -        Salmonella Monovalent H Antiserum, Factor i                   3 ml/vial -        Salmonella Monovalent H Antiserum, Factor k                    3 ml/vial -        Salmonella Monovalent H Antiserum, L Complex               3 ml/vial -        Salmonella Monovalent H Antiserum, Factors l,w              3 ml/vial -        Salmonella Monovalent H Antiserum, Factors l,v             3 ml/vial -        Salmonella Monovalent H Antiserum, Factor w               3 ml/vial -        salmonella Monovalent H Antiserum, Factor v                3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z13            3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z28          3 ml/vial -        Salmonella Monovalent H Antiserum, Factor r              3 ml/vial -        Salmonella Monovalent H Antiserum, Factor y               3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z              3 ml/vial -        Salmonella Monovalent H Antiserum, Z4 Complex         3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z23        3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z24        3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z32        3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z10         3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z29    3 ml/vial -        Salmonella Monovalent H Antiserum, Factor 2       3 ml/vial -        Salmonella Monovalent H Antiserum, Factor 5      3 ml/vial -        Salmonella Monovalent H Antiserum, Factor 6      3 ml/vial -        Salmonella Monovalent H Antiserum, Factor 7       3 ml/vial -        Salmonella Monovalent H Antiserum, Factor z6      3 ml/vial طقم 2 0
طقم نكستيرا لتحضير الحمض النووي DNA 7 مشخص Nextera XT DNA Library Prep. Kit -(Box1, Box2) (24 samples) طقم 3 0
طقم لعدد البكتيري الكلي تمبو 5 مشخص TEMPO KIT for AC Compatible to TEMPO -TEMPO cards 2 x 24 -TEMPO culture medium 2 x 24 vials طقم 4 0
طقم لعدد المجموعة القولونية تمبو 2 مشخص TEMPO KIT for Coliform count Compatible to TEMPO -TEMPO cards 2 x 24 -TEMPO culture medium 2 x 24 vials طقم 5 0

5 بند

جدول 65 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم معايرة العكارة لجهاز الفايتك Densichek Vitek2 10 مشخص buffers for calibration of denistik of vitek طقم 1 0
طقم فيداس للكشف عن السالمونيلا 5 مشخص VIDAS Salmonella kit - An automated qualitative test for use on the VIDAS instruments, for the detection of Salmonella in food and environmental samples, using the ELFA technique.- The kit contain the strips, conjugate and substrate 60 STIPS/KIT طقم 2 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن السالمونيلا 12 مشخص real time RT- qPCRkit for detection of Salmonella -Contains primer/probe mix for 96 reactions. - internal control set mix for 96 reactions. - Positive control lyophilized sample - PCR grade water - Master Mix (containing all PCR constituents essential for the rt PCR reaction. طقم 3 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن الكامبيلوباكتر جيوجيني 5 مشخص real time RT- qPCRkit for detection of campylobacter jejuni -Contains primer/probe mix for 96 reactions - internal control set mix for 96 reactions. - Positive control lyophilized sample - PCR grade water - Master Mix (containing all PCR constituents essential for the rt PCR reaction. طقم 4 0
طقم لعدد الاستافيلوكوكس اوريس تمبو 2 مشخص TEMPO KIT for staphylococcus aureus Compatible to TEMPO -TEMPO cards 2 x 24 -TEMPO culture medium 2 x 24 vials طقم 5 0

5 بند

جدول 66 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم استخلاص كياجن للحمض النووي دي ان اي النباتي 5 مشخص طقم استخلاص كياجن للحمض النووي دي ان أي النباتي DNeasy Plant Mini Kit (Qiagen) 50 test/kit طقم 1 0
طقم استخلاص بيونوبل للحمض النووي من النبات 5 مشخص طقم استخلاص بيونوبل للحمض النووي من النبات QuickPick SML Plant DNA Kit (BioNoble) 96 test/kit طقم 2 0
طقم ماستر مكس تاكارا 5 مشخص طقم ماستر مكس تاكارا Premix Ex Taq (Takara): Kit contents for 200 reactions: 1.0 ml: Premix Ex Taq (Perfect Real Time) (2X conc.) (the mix contains TaKaRa Ex Taq HS, dNTP Mixture, and Mg2+) 40 μl: ROX Reference Dye (50X conc.) 40 μl: ROX Reference Dye II (50X conc.) طقم 3 0
طقم ماستر مكس تاجمان عام 5 مشخص طقم ماستر مكس تاجمان عامTaqMan universal PCR master mix: The TaqMan Universal PCR Master Mix is supplied at 2X concentration and contains: • Taqman universal master mix with no AmpErase(Gold DNA Polymerase Ultra Pure • ROX™ Passive Reference. • with AmpErase UNG 2X conc. Kit enough for 2000 reaction. طقم 4 0
طقم مولد غاز لزراعة البكتريا اللاهوائية 30 مشخص طقم مولد غاز لزراعة البكتريا اللاهوائية (عبوة/ 10 ظروف). Anaerobic gas generating kit. عبوة 5 0

5 بند

جدول 67 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم مولد غاز لزرع بكتيريا كامبيلوباكتر 65 مشخص طقم مولد غاز لزرع بكتيريا كامبيلوباكتر (صندوق/10 ظروف) Campylobacter gas generating kits (10/box صندوق 1 0
طقم فيداس للكشف عن الكامبيلوباكتر جيو جيناي 5 مشخص VIDAS campylobacter kit An automated qualitative test for use on the VIDAS instruments, for the detection of Salmonella in food and environmental samples, using the ELFA technique. The kit contain the strips, conjugate and substrate 60 STIPS/KIT طقم 2 0
طقم فايتك حساسية البكتيريا سالبة الجرام للمضادات الحيوية 100 مشخص طقم فايتك حساسية البكتيريا سالبة الجرام للمضادات الحيوية (عبوة / 20) Vitek 2 AST cards for detection of antibiotic sensitivity of gram Negative bacteria VETERINARY طقم 3 0
طقم فايتك حساسية البكتيريا غير المخمرة للمضادات الحيوية 5 مشخص طقم فايتك حساسية مضادات حيوية للبكتيريا الغير مخمرة (عبوة / 20) Vitek 2 AST cards for detection of antibiotic sensitivity of Non fermenters bacteria طقم 4 0
طقم فايتك للكامبيلو باكتر NH 20 مشخص طقم فايتك للكامبيلو باكتر (عبوة / 20) NH VITEK2 ID FOR Campylobacter (NH). طقم 5 0

5 بند

جدول 68 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم real time qPCR لفيروس مرض هيربس 4 في الخيول 500 مشخص Equine Herps4 Real-Time PCR Detection kit: Real-time qPCR kit for detection of Equine Herps4 virus contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 1 0
طقم real time rt qPCR لفيروس مرض انيميا الخيل 500 مشخص EIA Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Equine Infectious Anemia virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 2 0
طقم real time RT qPCR لفيروس انفلونزا الخيول H7N7 يتوافق مع اجهزة شركة روش ABI BioRad 500 مشخص Eqine Influenza (H7N7) Real-Time PCR Detection kit: One-step real-time qPCR kit for specific detection of Eqine Influenza virus serotype (H7N7) contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.( يتوافق مع اجهزة شركة روش ,ABI, BioRad) اختبار 3 0
طقم real time RT qPCR لفيروس انفلونزا الخيول H3N8 يتوافق مع اجهزة شركة روش ABI BioRad 500 مشخص Eqine Influenza (H3N8) Real-Time PCR Detection kit: One-step real-time qPCR kit for specific detection of Eqine Influenza virus serotype (H3N8) contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 4 0
طقم real time RT qPCR لمرض غرب النيل قي الخيول 500 مشخص West Nile Fever Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of West Nile Fever virus contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 5 0

5 بند

جدول 69 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم real time RT qPCR لفيروس كورونا الجمال متلازمة الشرق الأوسط التنفسية 2000 مشخص MERS Corona Virus Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of two different MERS Corona virus targets (upE and orf1a) contains all reagents and controls for the specific detection of MERS Corona Virus (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 testsSupply with quality control certificate and validation report data.( يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 1 0
طقم real time RT qPCR لفيروس عائلة كابريبوكس يتوافق مع اجهزة روش 8000 مشخص Capripox Real-Time PCR Detection kit: Real-time qPCR kit for detection of Capripox virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data ( يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 2 0
طقم real time qPCRلفيروس مرض جدري الأغنام يتوافق مع اجهزة شركة روش 8000 مشخص Sheep Pox Real-Time PCR Detection kit: Real-time qPCR kit for detection of sheep pox virus contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe (taqman applcation) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data ( يتوافق مع اجهزة شركة روش ,ABI, BioRad ) إختبار 3 0
طقم real time RT qPCR لفيروس مرض حمى الابقار سريعة الزوال يتوافق مع اجهزة شركة روش 600 مشخص BEF Real-Time PCR Detection kit: One step real-time qPCR kit for detection of bove ephemeral fever virus contains all reagents and controls:(contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data (يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 4 0
طقم real time RT qPCR لفيروس مرض التهاب الانف والقصبة الهوائية المعدى فى الابقار 600 مشخص IBR Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Infectious bovine Rhinotrachieities virus contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 testsSupply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 5 0

5 بند

جدول 70 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم real time RT qPCR لفيروس مرض الإسهال البقري الفيروسي 600 مشخص BVD Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of BVD virus contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 testsSupply with quality control certificate and validation report data (يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة النوع أي جى إم لمرض حمى الوادي المتصدع 2500 مشخص طقم اليزا للكشف عن الاجسام المضادة النوع (أي جى إم) لمرض حمى الوادي المتصدع Immuno-capture ELISA for the detection of IgM antibodies against RVF. Detects IgM Antibody for RVFV nucleoprotein in serum of bovine, caprine and ovine. 5 plates. High sensitivity and specificity. Internationally validated. إختبار 2 0
طقم اليزا تنافسية للكشف عن الأجسام المضادة لمرض حمى الوادي المتصدع 20000 مشخص طقم اليزا تنافسية للكشف عن الأجسام المضادة لمرض حمى الوادي المتصدع Rift Valley Fever Competition Multi-species ELISA kit. able to detect antibodies in serum sample of diff. spp. including ruminants, camels, horses, dogs and others 10 plates High sensitivity and specificity. Internationally validated إختبار 3 0
طقم انتجين ملون للكشف عن المايكوبلازما جاليسبتكم 5000 مشخص Mycoplasma gallisepticum stained antigen. coloured antigen for plate agglutination test. 10 ml (200 test). Provided with positive and negative control serum (1 ml) with each kit.(10مل/عبوة) إختبار 4 0
طقم انتجين ملون للكشف عن المايكوبلازما ساينوفى 5000 مشخص Mycoplasma synoviae stained antigen coloured antigen for plate agglutination test. 10 ml (200 test). Provided with positive and negative control serum (1 ml) with each kit (10مل/عبوة) إختبار 5 0

5 بند

جدول 71 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا انترفيرون للكشف عن الاجسام المضادة لمرض السل البقري في الابقار 1500 مشخص Gamma- interferon ELISA kit for detection of antibodies against bovine TB. A sandwich ELISA for the detection of ovine, bovine, caprine and buffalo interferon gamma (IFN-g), which is produced in response to previous animal contact with the bacterium. High sensitivity and specificity. The kit should be supplied with bovine and avian PPD and all needed reagents. Supplied with control certificate and validation report data. kit/2 plates (192 reaction) (طقم/طبقين) إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة لمرض الحمى المجهولة في الحيوانات 15000 مشخص Indirect ELISA for detection of antibodies against Q fever in animals (multispp.) Detection of antibody against Q fever in ruminants and camel. High sensitivity and specificity Supply with control certificate and validation report data. 2 plates / kit.(طقم/طبقين) إختبار 2 0
طقم اليزا للكشف عن الاجسام المضادة لمرض الكلاميديا في الاغنام والماعز 12000 مشخص Indirect ELISA for detection of antibodies against Chlamydophilla abortus For the detection of antibodies against Chlamydophila abortus in serum and plasma of ruminants. 2 plates / kit. High sensitivity and specificity. Internationally validated (طقم/طبقين) إختبار 3 0
طقم اليزا للكشف عن الاجسام المضادة للمايكوبلازما اجالاكشي فى الاغنام والماعز 1250 مشخص ELISA for detection of antibodies against Mycoplasma agalactiae For the detection of antibodies against Mycoplasma agalactiae in serum and plasma of ruminants. 2 plates / kit. High sensitivity and specificity. Internationally validated (طقم/طبقين) إختبار 4 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لمرض الالتهاب الرئوي البلوري في الابقار 6000 مشخص C- ELISA for detection of antibodies against Mycoplasma mycoides subsp mycoides. For the detection of antibodies against CBPP in serum and cattle. 5 plates / kit. High sensitivity and specificity. Internationally validated (طقم/5 أطباق) إختبار 5 0

5 بند

جدول 72 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة لمرض اللستريا في الحيوانات 2000 مشخص ELISA for detection of antibodies against Listeria spp in animals. For the detection of antibodies against Lesteriosis in serum of animals. 1 plate / kit. High sensitivity and specificity.(طقم/طبق) إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة لمرض الكامبيلوباكتر في الحيوانات 2000 مشخص immuno capture ELISA for detection of Campylobacter fetus in transport medium in swab samples from cattle. 1 plate / kit. High sensitivity and specificity.(طقم/طبق) إختبار 2 0
طقم اليزا للكشف عن الاجسام المضادة لمرض اللبتوسبيرا في الحيوانات 2000 مشخص ELISA for detection of antibodies against Leptospira spp. For the detection of antibodies against leptospira spp. in serum and plasma of animals including sheep and cattle. one plate / kit. High sensitivity and specificity. Internationally validated (طقم/طبق) إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض السل الكاذب في الحيوانات 15000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض السل الكاذب في الحيوانات. Indirect ELISA for detection of antibodies against C. pseudotuberculosis in animals. (5 plates/ kit) (Creative diagnostics, (طقم/5 أطباق) إختبار 4 0
طقم اليزا للكشف عن انتجين فيروس مرض اللسان الأزرق 2500 مشخص ELISA for the dectection of Bluetongue Virus. 2 plates / kit. High sensitivity and specificity. Internationally validated (طقم/طبقين) اختبار 5 0

5 بند

جدول 73 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة لمرض طاعون الخيل الفيروسي 10000 مشخص ELISA for detection of antibodies against AHS blocking Elisa for detection of antibodies against African horse sickness (AHSV) in horse serum High sensitivity and specificity Internationally validated. 2 plates / Kit. إختبار 1 0
طقم اليزا لقياس فعالية التطعيم ضد مرض السعار 3000 مشخص ELISA Kit for detection of antibodies against rabies virus glycoprotein in canine: KIT FOR IN VITRO DETECTION AND TITRATION OF IgG ANTI RABIES VIRUS GLYCOPROTEIN IN DOGS, CATS AND FOXES SERUM. إختبار 2 0
طقم اليزا للكشف عن انتجين فيروس طاعون المجترات الصغيرة في صغار المجترات 8000 مشخص Immuno-capture ELISA for detection of PPR virus in small ruminants Immuno-capture sandwich Elisa. Allows rapid identification of PPR antigen in swabs from lesions, tears, and tissue samples. High sensitivity and specificity Internationally validated. 2 plates / Kit إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض اللسان الأزرق 8000 مشخص C- ELISA for detection of antibodies against blue tongue in animals. • Competitive Elisa. The kit is able to detect specific BTV antibody in serum and plasma of sheep, goats, cattle, buffalo, deer, and others High sensitivity and specificity Internationally validated. 5 plates / Kit إختبار 4 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا النوع A 8000 مشخص Competitive ELISA for detection of antibodies against influenza type A the kit is able to detect antibodies in serum of birds, horses and pigs (multispecies) High sensitivity and specificity Internationally validated. 5 plates / Kit. إختبار 5 0

5 بند

جدول 74 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقمrtPCR للكامبيلوباكتر فيتس يتوافق مع اجهزة روش وأي بي أي وبيوراد 800 مشخص Real Time PCR kit for detection of Campylobacter fetus compatible with ABI and Biorad systems. It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data., 100 tests إختبار 1 0
طقم rtPCR لانواع اللبتوسبيرا يتوافق مع اجهزة روش وأي بي أي وبيوراد 1000 مشخص Real Time.PCR kit for detection of Leptospira species compatible with ABI and Biorad systems.• It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data ., 100 tests إختبار 2 0
طقم rtPCR للكلاميدوفيلا ابورتس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1000 مشخص Real Time PCR kit for detection of Chlamydophila abortus compatible with ABI and Biorad systems.• RT.PCR kit for detection of Chlamydophila abortus. It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer., 100 tests The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data إختبار 3 0
طقمrtPCR لمرض خناق الخيل 800 مشخص rtPCR kit FOR detection of Strept equi- specific primer/probe mix.- Positive control template.- RNAse/DNAse free water.- Template preparation buffer., 100 tests The kit should be provided with the suitable qPCR mastermix. Supply with control certificate and validation report data ( يتوافق مع اجهزة روش وأي بي أي وبيوراد) اختبار 4 0
طقم rtqPCR لفيروس مرض الحمى القلاعية عام يتوافق مع اجهزة شركة روش ABI BioRad 5000 مشخص FMD Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV virus (all serotypes) contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target ., 100 testsSupply with quality control certificate and validation report data. إختبار 5 0

5 بند

جدول 75 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtqPCR لفيروس مرض طاعون المجترات الصغيرة يتوافق مع اجهزة شركة روش 6000 مشخص PPR Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of peste des petit ruminant virus contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 testsSupply with quality control certificate and validation report data ( يتوافق مع اجهزة شركة روش ,ABI, BioRad ) إختبار 1 0
طقم rtqPCR لفيروس مرض جدري الجمال 1000 مشخص Camel Pox Real-Time PCR Detection kit: Real-time qPCR kit for detection of camel pox virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data ( يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 2 0
طقم rtqPCR لفيروس الأورف 1000 مشخص Orf Real-Time PCR Detection kit: Real-time qPCR kit for detection of Orf virus contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data (يتوافق مع اجهزة شركة روش ,ABI, BioRad ) إختبار 3 0
طقم rtqPCR لفيروس مرض طاعون الخيل 2000 مشخص AHS Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of African Horse Sickness virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.( يتوافق مع اجهزة شركة روش و ABI و BioRad) إختبار 4 0
طقم rtPCRلفيروس مرض النيوكاستيل F gen يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 3000 مشخص NDV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of New Castel Disease virus (F gene)contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls).The kit allows simultaneous differentiation and quantification of common live vaccine strains and the more pathogenic field strain of Newcastle Disease Virus. Highly specific detection profile, Sensitive to 10 copies of target., 100 tests.Supply with quality control certificate and validation report data. اختبار 5 0

5 بند

جدول 76 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان7 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 5000 مشخص Avian Influenza subtype N7 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N7 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 1 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش 9 ان 2 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 5000 مشخص Avian Influenza subtype H9N2 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H9N2 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 2 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش 7 ان9 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 5000 مشخص Avian Influenza subtype H7N9 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H7N9 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 3 0
طقم rtPCRلفيروس مرض النيوكاستل ماتريكس جين يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 3000 مشخص NDV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of New Castel Disease virus ( Matrix gene)contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. اختبار 4 0
طقم اليزا للكشف عن الاجسام المضادة لفيروس مرض الحمى القلاعية النوع O 3000 مشخص طقم اليزا للكشف عن الاجسام المضادة لفيروس مرض الحمى القلاعية النوع O Solid-phase competitive ELISA for detection of antibodies against FMD virus serotype O. • Detects antibodies against O serotype (differentiate it from other serotypes) • High sensitivity and specificity • Internationally validated • 5 plates (90 spot test/plate) إختبار 5 0

5 بند

جدول 77 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة لفيروس مرض الحمى القلاعية النوع A 2000 مشخص طقم اليزا للكشف عن الاجسام المضادة لفيروس مرض الحمى القلاعية النوع A Solid-phase competitive ELISA for detection of antibodies against FMD virus serotype A. Detects antibodies against A serotype (differentiate it from other serotypes) High sensitivity and specificity Internationally validated. 5 plates (90 spot test/plate) إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة لفيروس مرض الحمى القلاعية النوع ASIA 1 1000 مشخص ASIA 1 Solid-phase competitive ELISA for detection of antibodies against FMD virus serotype ASIA 1. Detects antibodies against ASIA 1 serotype (differentiate it from other serotypes) High sensitivity and specificity Internationally validated 5 plates / kit (90 spot test/plate) إختبار 2 0
طقم اليزا للكشف عن انتيجينات فيروس مرض الحمى القلاعية 3000 مشخص ELISA for detection of FMD virus and serotyping of FMD O, A, ASIA 1, SAT1, SAT2 and C. Detects antigens of FMD virus. High sensitivity and specificity. Internationally validated. 5 plates (10 tests/plate) إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض التوكسوبلازما في الحيوانات 2500 مشخص Indirect ELISA for detection of antibodies against Toxoplasma gondii multispecies. Detects antibodies against Toxoplasma in serum and plasma in animals. High sensitivity and specificity. Internationally validated. 2 Plates/ kit. إختبار 4 0
طقم اليزا تنافسية للكشف عن الأجسام المضادة لمرض طاعون المجترات الصغيرة 10000 مشخص C-ELISA for detection of antibodies against Peste des Petitis ruminants. Competitive Elisa Detects antibodies against PPR in serum or plasma of goat and sheep. High sensitivity and specificity Internationally validated. 4 plates / kit إختبار 5 0

5 بند

جدول 78 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم انتجين ملون للكشف عن السالمونيلا بلورم 5000 مشخص Salmonella pullorum stained antigen coloured antigen for plate agglutination test. Provided with positive and negative control serum (1 ml) with each kit. (10مل/عبوة) إختبار 1 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لمرض الالتهاب الرئوي البلوري في الماعز طقم 5 أطباق 10000 مشخص C-ELISA for detection of Antibodies against CCPP. Detects Antibodies against CCPP in serum of small ruminants. 5 plates/kit. High sensitivity and specificity. Internationally validated. إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة للمرض العابر للحدود 500 مشخص طقم اليزا للكشف عن الأجسام المضادة للمرض العابر للحدود C-ELISA for serodiagnosis of boarder disease Detects Antibodies against the disease in serum, plasma and milk of cattle, sheep, and goats. Plates (strip-well 8X12). High sensitivity and specificity. Internationally validated. إختبار 3 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لفيروس مرض الانيميا المعدي في الخيول 5000 مشخص Equine Infectious Anemia double antigen. Detects Antibodies against EIA in serum of horses. 5 plate. High sensitivity and specificity. Internationally validated. إختبار 4 0
طقم اليزا للكشف عن الأجسام المضادة النوع m لمرض حمى غرب النيل في الخيول 10000 مشخص طقم اليزا للكشف عن الأجسام المضادة (النوع m) لمرض حمى غرب النيل في الخيول Elisa Test Kit for the detection of IgM Antibody for West Nile Virus in horses. Detects IgM Antibody for West Nile Virus in serum of horses. 5 plates. High sensitivity and specificity. Internationally validated. إختبار 5 0

5 بند

جدول 79 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لمرض الرعام في الخيول 6000 مشخص Double antigen ELISA for the detection of antibodies directed against Burkholderia mallei in serum or plasma from horses, donkeys, mules. 2 plates/kit. High sensitivity and specificity. • Internationally validated (طقم/طبقين) إختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة لمرض الثايليريا في الخيول 1500 مشخص Competitive ELISA (cELISA) for detection of antibodies against Theileria equi horse. detect antibodies in serum of horse High sensitivity and specificity. Internationally validated. 2 plates (طقم/طبقين) إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الخناق في الخيول طقم طبقين 3840 مشخص Elisa Test Kit for the detection of antibodies against Strangles in horses. Detects Antibody in serum of horses against the bacteria causing strangles . 2 plates / kit. High sensitivity and specificity. Internationally validated إختبار 3 0
طقم اليزا للكشف عن الاجسام المضادة لفيروس كورونا في أمصال الإبل 1500 مشخص طقم اليزا للكشف عن الاجسام المضادة لفيروس كورونا في أمصال الإبل Anti-MERS -CoV Elisa Camel (IgG) The kit detects specific IgG antibodies against the purified S1 antigen of MERS-CoV.1 plate. إختبار 4 0
طقم اليزا للكشف عن حمى الثلاث ايام فى الأبقار 2000 مشخص طقم اليزا للكشف عن حمى الثلاث ايام فى الأبقار: ELISA for detection of Antibodies against Bovine ephemeral fever. • Elisa for detection of antibodies against Bovine ephemeral fever • High sensitivity and specificity. • Internationally validated. • 1 plates/kit إختبار 5 0

5 بند

جدول 80 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة لمرض الهربس في الخيول 2000 مشخص indirect ELISA- type specific recombinant glycoprotein G fusion proteinto detect equine herpes virus type1 and 4 in Equine sera. 5 plates. High sensitivity and specificity. • Internationally validated. إختبار 1 0
طقم فايتك حساسية البكتيريا موجبة الجرام للمضادات الحيوية 10 مشخص طقم فايتك حساسية البكتيريا موجبة الجرام للمضادات الحيوية (عبوة / 20) Vitek 2 AST cards for detection of antibiotic sensitivity of gram positive bacteria VETERINARY طقم 2 0
طقم إليزا للكشف عن مرض جدري البرقوق 2500 مشخص طقم إليزا للكشف عن مرض جدري البرقوق DAS-ELISA complete kit for the detection of Plum pox virus (Scharka) PPV Kit contains ≤ 500 tests. Kit contains positive & negative controls. إختبار 3 0
طقم إليزا للكشف عن مرض تقزم الخوخ 5 مشخص طقم إليزا للكشف عن مرض تقزم الخوخ ELISA complete kit for the detection of Prune Dwarf Virus (PDV): Kit contains ≤ 500 tests. kit contains positive & negative controls طقم 4 0

4 بند

جدول 81 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم إليزا الكشف عن بكتيريا العفن البني في البطاطس 5 مشخص طقم إليزا للكشف عن بكتيريا مرض العفن البني في البطاطس DAS-ELISA complete kit for the detection of Ralstonia solanacearum (Potato Brown Rot Bacteria). Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 1 0
طقم إليزا الكشف عن بكتيريا العفن الحلقي في البطاطس 5 مشخص طقم إليزا للكشف عن بكتيريا العفن الحلقي في البطاطس DAS-ELISA complete kit for the detection of Clavibacter m. ssp.sepedonucus (Potato Ring Rot Bacteria) Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 2 0
طقم اليزا للكشف عن فيروس برقشة اوراق الطماطم 5 مشخص طقم اليزا للكشف عن فيروس برقشة أوراق الطماطم DAS-ELISA complete kit for the detection of Tomato Mottle Virus (ToMoV). Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 3 0
طقم اليزا للكشف عن فيروس التيرستيزا في الحمضيات 5 مشخص طقم إليزا للكشف عن فيروس التيرستيزا في الحمضيات ELISA complete kit for the detection of Citrus Tristeza Closter Virus (CTV).Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 4 0
طقم اليزا للكشف عن فيروس التفاف الاوراق الاصفر في الطماطم 5 مشخص طقم إليزا للكشف عن فيروس التفاف الأوراق الأصفر في الطماطم TAS-ELISA complete kit for the detection of Tomato Yellow Leaf Curl Virus (TYLCV). Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 5 0

5 بند

جدول 82 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن بكتيريا مرض التقرح البكتيري في الموالح 5 مشخص طقم إليزا للكشف عن بكتيريا مرض التقرح البكتيري في الموالح DAS-ELISA complete kit for the detection of Xanthomonas citri subsp. citri (citrus bacterial cancre) Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 1 0
طقم اليزا للكشف عن بكتيريا مرض تفرع التفاح 5 مشخص طقم إليزا للكشف عن بكتيريا مرض تفرع التفاح. DAS-ELISA complete kit for the detection of Candidatus Phytoplasma mali (apple proliferation) Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 2 0
طقم اليزا للكشف عن بكتيريا العفن الحلقي في الطماطم 5 مشخص طقم إليزا للكشف عن بكتيريا العفن الحلقي في الطماطم DAS-ELISA complete kit for the detection of Clavibacter m. ssp. michiganensis (Tomato Ring Rot). Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 3 0
طقم اليزاللكشف عن بكتيريا اللفحة النارية التفاح الكمثري 5 مشخص طقم إليزا للكشف عن بكتيريا اللفحة النارية (التفاح، الكمثري) DAS-ELISA complete kit for the detection of Erwinia amylovora (Fire Blight). Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 4 0
طقم إليزا للكشف عن بكتيريا الذبول البكتيري الذرة الشامية 5 مشخص طقم إليزا للكشف عن بكتيريا الذبول البكتيري (الذرة الشامية) DAS-ELISA complete kit for the detection of Pantoea stewartii ssp. stewartii (Bacterial Wilt) Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 5 0

5 بند

جدول 83 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم إليزا للكشف عن بكتيريا التدهور السريع الزيتون 5 مشخص طقم إليزا للكشف عن بكتيريا التدهور السريع (الزيتون) DAS-ELISA complete kit for the detection of Xylella fastidiosa (Pierce´s Disease bacteria). Kit contains ≤ 500 tests. kit contains positive & negative controls. طقم 1 0
طقم اليزا للكشف عن الأجسام المضادة لمرض انيميا الطيور 1000 مشخص طقم اليزا للكشف عن الأجسام المضادة لمرض انيميا الطيور Indirect ELIAS kit for serodiagnosis of Chicken Infectious Anemia The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well stripHigh sensitivity and specificity.Internationally validated.Supply with control certificate and validation report data إختبار 2 0
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع SAT1 3000 مشخص FMD type SAT1 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV serotype SAT1 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data (يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 3 0
طقم RTqPCR مرض اللسان الأزرق يتوافق مع اجهزة شركة روش 2000 مشخص BTV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Blue Tongue Virus(all serotypes) contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.( يتوافق مع اجهزة شركة روش ABI, BioRad) إختبار 4 0
طقم اليزا للكشف عن الاجسام المضادة لمرض البابيزيا في الخيول 1500 مشخص Competitive ELISA (cELISA) for detection of antibodies against Babesia caballi in horse. detect antibodies in serum of horse High sensitivity and specificity. Internationally validated. 2 plates (طقم/طبقين) إختبار 5 0

5 بند

جدول 84 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
اختبار كات لتشخيص مرض التربانوسوما 4000 مشخص ختبار كات لتشخيص مرض التربانوسوما CATT test (Card Agglutination Test for trypansomiasis )Test kit containing all reagents and accessory materials + protocol. 250 test/kit. Freeze dried reagents (antigen, controls). إختبار 1 0
سيرم مرجعي لمرض البروسيلا ضبط جودة اختبار الروز بنغال 20 مشخص Brucellosis Positive Control serum (for quality control of Rose Bengal reagent) Can be used with different antigens and ELISA reagents to detect brucellosis. 1 ml volume. Lyophilized. Internationally certified عبوة 2 0
اختبار لاتكس للكشف عن مرض الالتهاب الرئوي البلوري فى الماعز 50 مشخص Latex agglutination test for serodiagnosis of CCPP • 2 ml reagent. Negative and positive control. Reaction slides. 20 disposable droppers Internationally validated. طقم 3 0
اختبار لاتكس للكشف عن السالمونيلا 100 مشخص Latex agglutination test for detection of salmonella • Can be used for presumptive identification of Salmonella isolated on selective agar plates. 30 test/kit (30 اختبار/طقم) طقم 4 0
سيرم مرجعي للتلازن الدموي لمرض أنفلونزا الخيول للعترة نوع اتش 3 12 مشخص Reference HI Antiserum for Equine Influenza virus subtype type H3 Lyophilized. عبوة 5 0

5 بند

جدول 85 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي للكشف عن بكتيريا السالمونيلا O 8 مشخص سيرم مرجعي للكشف عن بكتيريا السالمونيلا O Salmonella Reference serum ( Poly O) Can be used to detect salmonella isolated colonies. 1 to 3 ml volume. Internationally certified عبوة 1 0
سيرم مرجعي للكشف عن بكتيريا السالمونيلا H 8 مشخص سيرم مرجعي للكشف عن بكتيريا السالمونيلا H Salmonella Reference serum ( Poly H) Can be used to detect salmonella isolated colonies. 1 to 3 ml volume. Internationally certified عبوة 2 0
سيرم مرجعي لجدري الأغنام لاختبار التعادل المصلي SNT 1 مل 5 مشخص سيرم مرجعي لجدري الأغنام لاختبار التعادل المصلي SNT 1 مل Standard reference antisera for sheep pox virus neutralization test: - (lyophilized 1 ml) عبوة 3 0
مجموعة أمصال مرجعية لجنس الكلوستريديا 2 مشخص مجموعة أمصال مرجعية لجنس الكلوستريديا (عبوة/مل) Standard reference antisera for Clostridium spp.: C. perfringens types A, B, C, D and E. C novyii types A and B. C. chauvei and C. septicum and C. sordelli. - Lyophilized. - 1ml/container. - 2 from each type عبوة 4 0
مصل الخيل المعقم لزرع المايكوبلازما 100 مل 5 مشخص Horse serum for the cultivation of mycoplasma: 100 ml/bottle. Sterile/filtered. Shipping frozen in dry ice. EIA tested عبوة 5 0

5 بند

جدول 86 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أمصال مرجعية ضد البروتينات الغير بنائية 3ABC لفيروس الحمى القلاعية 10 مشخص reference antisera against non structural protiens (3ABC) of FMDV (pirbright panel) (lyophilized 1 ml),prefer with known titers. عبوة 1 0
أمصال مرجعية ضد فيروس الحمى القلاعية العترة O 5 مشخص reference antisera against FMDV serotype O (pirbright panel) (lyophilized 1 ml),prefer with known titers. عبوة 2 0
أمصال مرجعية ضد فيروس الحمى القلاعية العترة A 5 مشخص reference antisera against FMDV serotype A (pirbright panel) (lyophilized 1 ml),prefer with known titers. عبوة 3 0
أمصال مرجعية ضد فيروس الحمى القلاعية العترة2 SAT 5 مشخص reference antisera against FMDV serotype SAT2 (pirbright panel) (lyophilized 1 ml),prefer with known titers. عبوة 4 0
امصال مرجعية لفيروس مرض اللسان الازرق لتقييم مشخصات الاليزا 5 مشخص reference antisera for BTV (pirbright panel) (lyophilized 1 ml),prefer with known titers to help in titeration. عبوة 5 0

5 بند

جدول 87 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
امصال مرجعية لفيروس مرض طاعون المجترات الصغيرة لتقييم مشخصات الاليزا 5 مشخص reference antisera against PPR virus (lyophilized 1 ml) عبوة 1 0
انتجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز A 5 مشخص Reference Antigen for Clostridium perfringens A Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجن مرجعي لفيروس حمى الوادي المتصدع 5 مشخص Refernce Anigen fo Rit vally Fever virus For PCR test عبوة 3 0
انزيم تضخم المادة الوراثية 7 مشخص SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (100 reactions). • 50uL SuperScript III RT/Platinum Tag Mix. • 1 mL 2X Reaction Mix (containing 0.4 mM of each dNTP, 3.2 mM MgSO4). 500 uL mM Magnesium Sulfate عدد 4 0
اختبار لاتكس كامبيلوباكتر 12 مشخص latex agglutination test for campylobacter 100 TEST Include control positive and control negative طقم 5 0

5 بند

جدول 88 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انزيم ليغيز T4 1 مشخص T4 RNA Ligase 2 (dsRNA) T4 RNA Ligase 2 ligates nicks in dsRNA and can also be used to ligate the 3´ OH of RNA to the 5´ phosphate of DNA in a double stranded structure • Suitable for ligating 3' OH of RNA to 5' phosphate of DNA in a DNA/RNA hybrid • Isolated from a recombinant source • Supplied with 10X Reaction Buffer عدد 1 0
مجموعات بوادئ للتتابع النيكليوتيدي الفيروسي لجهاز السكونسر 15 مشخص Primers for viral sequencing: - Package: 25 nmol / primer unit. - 4 primers/group. - HPLC quality طقم 2 0
ضابط ايجابي للسالمونيلا لجها ز البي سي ار المتنقل 10 مشخص POCKIT cen Salmonella spp P(+) CON.R عبوة 3 0
ضابط ايجابي للبروسيلا مليتنسيس لجها ز البي سي ار المتنقل 10 مشخص POCKIT cen Brucella melitensis P(+) CON.R عبوة 4 0
ضابط ايجابي للبروسيلا ابورتس لجها ز البي سي ار المتنقل 10 مشخص POCKIT cen Brucella abortus P(+) CON.R عبوة 5 0

5 بند

جدول 89 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
ضابط ايجابي انفلونزا الطيور النوع اتش 5 خاص بجهاز تفاعل البلمرة المتسلسل المتنقل 10 مشخص Positive Control influenza H5 p(+)control reagent pockit عبوة 1 0
ضابط ايجابي انفلونزا الطيور النوع اتش 9 خاص بجهاز تفاعل البلمرة المتسلسل المتنقل 10 مشخص Positive Control influenza H5 p(+)control reagent pockit عبوة 2 0
ضابط ايجابي لفيروس الحمى القلاعية لجها ز البي سي ار المتنقل 40 مشخص Positive Control POCKIT cen FMDV P(+) CONTROL عبوة 3 0
ضابط ايجابي لفيوس حمى الوادي المتصدع لجها ز البي سي ار المتنقل 25 مشخص Positive Control POCKIT cen RVF (L gene) P(+) CONTROL عبوة 4 0
ضابط ايجابي لفيوس التهاب الجلد العقدي لجها ز البي سي ار المتنقل 10 مشخص Positive Control POCKIT cen LSDV P(+) CONTROL عبوة 5 0

5 بند

جدول 90 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
ضابط ايجابي لفيروس اللسان الازرق لجها ز البي سي ار المتنقل 10 مشخص Positive Control POCKIT cen bluetongue virus P(+) CONTROL عبوة 1 0
ضابط ايجابي لفيروس طاعون المجترات الصغيرة لجها ز البي سي ار المتنقل 25 مشخص Positive ControlPOCKIT cen PPRV virus P(+)CONTROL عبوة 2 0
ضابط ايجابي لفيروس كورونا ميرس اب أي جين لجها ز البي سي ار المتنقل 10 مشخص Positive Control MERS-COV (upE) P(+) CONTROL عبوة 3 0
مشخصات rtPCR للكشف عن الحمى الصفراء يتوافق مع أجهزة شركة API Roche Biorad 250 مشخص YELLOW FEVER VIRUS Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of YELLOW FEVER VIRUS contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 4 0
مشخصات rtPCR للكشف عن فيروس الشيكونجونيا يتوافق مع أجهزة شركة API Roche Biorad 250 مشخص CHIKV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Chikungunya virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 5 0

5 بند

جدول 91 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
مشخصات rtPCR للكشف عن فيروس الزيكا يتوافق مع أجهزة شركة API Roche Biorad 150 مشخص Zika Virus Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Zika virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 1 0
مشخصات rtPCR للكشف عن حمى الضنك يتوافق مع أجهزة شركة API Roche Biorad 500 مشخص DENGV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Dengue virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 2 0
مشخصات rtPCR للكشف عن حمى الخرمة يتوافق مع أجهزة شركة API Roche Biorad 100 مشخص Alkhurma hemorrhagic fever virus Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Alkhurma hemorrhagic fever virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 3 0

3 بند

جدول 92 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
اختبار لاتكس للكشف عن الالتهاب الرئوي البلوري المعدى فى الابقار 25 مشخص Latex agglutination test for serodiagnosis of CBPP • 2 ml reagent Negative and positive control. Reaction slides. 20 disposable droppers Internationally validated. طقم 1 0
ضابط ايجابي انفلونزا الطيور انوع أ خاص بجهاز تفاعل البلمرة المتسلسل المتنقل 60 مشخص Positive Control Influenza A Reagent Compatible with Pockit Central. 4 vial Positive Control reagent -lyohilsed /package + 4Positive Control buffer vials. IIPCR. عبوة 2 0
مجموعة بادئات لتضخيم قطع الجينات لفيروس اللسان الأزرق 10نانومول عبوة 2 مشخص Sets of primers for BT virus. 2 primer pairs/group عدد 3 0

3 بند

جدول 93 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع O يتوافق مع اجهزة شركة روش ABI BioRad 3000 مشخص FMD type O Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV serotype O contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad ) إختبار 1 0
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع A يتوافق مع اجهزة شركة روش 2000 مشخص FMD type A Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV serotype A contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 testsSupply with quality control certificate and validation report data.(يتوافق مع اجهزة شركة روش ,ABI, BioRad) إختبار 2 0
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع SAT2 4000 مشخص FMD type SAT2 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV serotype SAT2 contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with ROCHE,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. ( يتوافق مع اجهزة شركة روش ,ABI, BioRad ) إختبار 3 0
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع Asia1 1000 مشخص FMD type Asia1 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV serotype Asia1 contains all reagents and controls:(contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. (يتوافق مع اجهزة شركة روش ,ABI, BioRad ) إختبار 4 0
طقم rtqPCR لفيروس مرض التهاب الجلد العقدي 2000 مشخص LSD Real-Time PCR Detection kit: Real-time qPCR kit for detection of Lumpy Skin Disease virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data (يتوافق مع اجهزة شركة روش ABI BioRad) إختبار 5 0

5 بند

المستندات الداعمة (9 ملف)

الشروط والأحكام لآلية التفضيل السعري للمنتج الوطني 1.pdf

معلق
فتح

التعليمات الخاصة بتسليم المنتجات الوطنية 2024 1.pdf

معلق
فتح

نموذج التأهيل.zip

معلق
فتح

مكان تسليم العروض 6 1 2 1.pdf

معلق
فتح

معايير التوريد تامين المشخصات المخبرية للامراض الحيوانية.pdf

معلق
فتح

الشروط الخااصة.pdf

معلق
فتح

ملحق تقييم العروض -.pdf

معلق
فتح

جدول الاصناف.pdf

معلق
فتح

جدول الاستلام.pdf

معلق
فتح

لم يتم ترسية هذه المنافسة بعد

الآليات

آلية التفضيل السعري للمنتج الوطني

وثائق المحتوى المحلي

معايير التقييم

معايير التقييم الفني

المستوى الاول المستوى الثاني المستوى الثالث الوزن النهائي
التقييم الفني

معايير التقييم المالي

المستوى الاول المستوى الثاني المستوى الثالث الوزن النهائي
التقييم المالي السعر التكلفة الكلية 100%

أخبار المنافسة

title تاريخ الإنشاء
value 05/07/46 01:09:59 م
title تاريخ فتح العروض
value 02/09/46 10:00:00 ص
title تمديد تواريخ المنافسة
value تاريخ فتح العروض02/09/46 10:00:00 صآخر موعد لتقديم العروض01/09/46 10:00:00 صآخر موعد لإستلام الإستفسارات26/08/46 12:00:00 ص
title تاريخ الترسيه
value 23/03/1447