منافسة إتفاقية إطارية قيد التنفيذ

تأمين المشخصات والمستلزمات المخبرية للأمراض الحيوانية

المركز الوطني للوقاية من الآفات والامراض الحيوانية ومكافحتها

رقم المنافسة

250539000419

المعرّف

#939546

رقم المنافسة
250539000419
رقم المنافسة الداخلي
الجهة الحكومية
المركز الوطني للوقاية من الآفات والامراض الحيوانية ومكافحتها
الفرع / الإدارة
المركز الوطني للوقاية من الآفات النباتية والأمراض الحيوانية ومكافحتها (مركز وقاء)
نوع المنافسة
منافسة إتفاقية إطارية
حالة المنافسة
مرحلة الترسية
طريقة تقديم العروض
ملفين منفصلين ( فني ومالي)
رسوم الاشتراك
500 ر.س
سعر كراسة الاشتراط
300 ر.س
تكلفة الدعوة
200 ر.س
تكلفة الشراء
500 ر.س
الضمان الإبتدائي
الضمان النهائي
مدة العقد
1095 يوم
التأمين مطلوب
لا
مدة الوقفة (أيام)
5
داخل المملكة
نوع الاتفاقية
مفتوحة
مدة الاتفاقية
3 سنوات 0 الشهر 0 أيام

الغرض من المنافسة

تأمين المشخصات والمستلزمات المخبرية للأمراض الحيوانية

التاريخ ميلادي هجري
تاريخ النشر 2025/05/11 08:39
آخر موعد للاستفسارات 2025/06/19 1446-12-23
آخر موعد تقديم العروض 2025/06/29 10:00 1447-01-04
موعد فتح العروض 2025/06/29 10:00 1447-01-04
موعد فحص العروض
التاريخ المتوقع للترسية 2025/06/15 1446-12-19
تاريخ بدء الأعمال 2025/06/25 1446-12-29
تاريخ خطاب تأكيد المشاركة
بداية إرسال الأسئلة 2025/06/28 1447-01-03
أقصى مدة للإجابة 10 يوم
مكان فتح العروض الكتروني عبر منصة مركز وقاء
مدة الوقفة 5 يوم

موقع التنفيذ

منطقة التنفيذ
منطقة الرياض
مدن التنفيذ
الرياض
موقع التنفيذ
داخل المملكة

مجال التصنيف

مجال التصنيف
غير مطلوب
يشمل مواد توريد
لا

الأنشطة

  • مستودعات الادوية والصيدليات - المستلزمات الطبية

جدول 1 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم ناسخ للحمض النووي للتحليل الجيني 100 تفاعل 4762 تجهيزات مخبرية Transcriptor first strand cDNA synthesis kit • Transcriptor Reverse Transcriptase (20 U/µL).• Transcriptor RT Reaction Buffer, 5x concentrated/ (NOT LESS THAN 2X CONC.)• Protector RNase Inhibitor (40 U/µL).• dNTP Mix(10- m M EACH), PCR Grade• Anchored Oligo (dT)15-18 (50 µM) Primer• Random Hexamer (600µM) Primer• Control RNA template• forward primer (10µM)• reverse primer (10µM)• Water, PCR grade,100 Reactions إختبار 1 0
طقم إختبار تفاعل البلمرة المتسلسل التقليدي100 تفاعل 7143 تجهيزات مخبرية Hot Start PCR Master Mix kit :is a ready-to-use 2X solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient PCR amplification of DNA templates. The PCR Master Mix is designed for routine endpoint PCR for DNA amplicons in the range of 0.2–2kb to cover routine PCR and High Fidelity PCR needs.PCR Master Mix is stable for 3 months when stored at 4°C.,100 Reactions إختبار 2 0
طقم إختبار تفاعل البلمرة المتسلسل التقليدي في خطوة واحدة100 تفاعل 2381 تجهيزات مخبرية One Step RT-PCR Master Mix Kit: is designed for a Highly Efficient cDNA Synthesis and PCR in a single tube including the RNA template.supplied in a 2x concentration to perform standard PCR, Highly Efficient,high fidelity kit.,100 Reactions إختبار 3 0
طقم إختبار تفاعل البلمرة المتسلسل االلحظي بتقنية التاكمان100 تفاعل 2381 تجهيزات مخبرية TaqMan real-time PCR master mixe kit : 2X Master Mix for TaqMan probe-based real-time PCR (including: Taq HotStart DNA Polymerase, reaction buffer, dNTPs, and MgCl2 ). Optimized for high sensitivity and PCR yield .,100 Reactions إختبار 4 0
طقم إختبار تفاعل البلمرة المتسلسل اللحظي في خطوة واحدة بتقنية التاكمان100 تفاعل 4762 تجهيزات مخبرية One StepTaqMan real time PCR Master Mix: The kits contain all reagents required for RT-qPCR to ensure fast and easy preparation (including:effecient cDNA synthesis, Taq HotStart DNA Polymerase, reaction buffer, dNTPs, and MgCl2 ).The Kit Optimized for high sensitivity and yield,100 Reactions إختبار 5 0
طقم للمعايرة الطيفية يتوافق مع جهاز ABI 7500 10 تجهيزات مخبرية ABI 7500 7500 Real-Time PCR Systems Spectral Calibration Kit I Includes one background plate, seven spectral calibration plates with FAM™/SYBR™ Green I, VIC™/JOE™, and NED™/TAMRA™/ROX™ dye standards, and one ROI calibration plate.7500 Real-Time PCR Systems Spectral Calibration Kit II طقم 6 0
طقم تعادل الألوان لأنظمة لايت سيكلور 10 تجهيزات مخبرية LightCycler Color Compensation set طقم 7 0
طقم استخلاص الحمض النووي من العينات البرازية يدويا 952 تجهيزات مخبرية DNA extraction stool kit.• For 50 DNA preps: 50 Mini Spin Columns, Proteinase K, Inhibit EX tablets, Buffers, Collection Tubes (2 ml). إختبار 8 0
طقم استخلاص أر إن ايه للحامض النووي الفيروسي يدويا 2381 تجهيزات مخبرية Viral RNA Isolation kit for rapid and simple purification of viral RNA of the highest integrity from a variety of sources,with fast spin-column procedures ,96 reactions إختبار 9 0
طقم استخلاص الحمض النووي من عينات الانسجة والدم يدويا 2381 تجهيزات مخبرية DNA extraction blood and Tissue Kit. For 4 x 96 DNA minipreps: 4 X 96 well Plates, Proteinase K, Buffers, S-Blocks, AirPore Tape Sheets, Collection Microtubes (1.2 ml), Elution Microtubes RS, Caps, 96-Well Plate Registers إختبار 10 0
طقم استخلاص الحامض النووي خاص بجهاز تفاعل البلمرة المتسلسل المتنقل IIPCR 476 مشخص (IIPCR). Cartridge Set for Nucleic Acid Extraction Compatible with Pockit Central. Content: Transfer Cartridge:24 test/package, Extraction Cartridge: contain all reagent for Nucleic Acid Extraction. طقم 11 0
طقم استخلاص الحمض النووي العام يتوافق مع جهاز استخلاص كنغ فيشر 96 يحتوي على جميع ملحقات تشغيل النظام كينج فيشر فليكس 7143 تجهيزات مخبرية Core RNA/DNA Extraction Kit compatible with King Fisher 96, Nucleic acid extraction device • Universal Pathogen kit, for Bacteria, Virus and Parasites from different samples including feces. • All required consumables should be included. • Should be provided with 100% isopropanol and 100% ethanol bottles. 480 reactions. Including all consumables for 96 extraction instrument. اختبار 12 0
طقم استخلاص الحمض النووي يتوافق مع جهاز ماجنابيور 24 مع كامل ملحقاته 17 تجهيزات مخبرية MagNA Pure 24 Total NA Isolation Kit contains prefilled and ready-to-use reagent cassettes and magnetic glass particles (MGPs) vials, for use with the MagNA Pure 24 System,and all other contents and accessories needed to perfrm the test, 96 isolations. طقم 13 0
طقم استخلاص الحمض النووي العام يتوافق مع جهاز استخلاص كنغ فيشر 24 يحتوي على جميع ملحقات تشغيل النظام كينج فيشر دو 14286 تجهيزات مخبرية Core RNA/DNA Extraction Kit compatible with King Fisher 24 Nucleic acid extraction device • Universal Pathogen kit, for Bacteria, Virus and Parasites from different samples including feces. • All required consumables should be included. • Should be provided with 100% isopropanol and 100% ethanol bottles. 480 reactions. Including all consumables for 24 extraction instrument. اختبار 14 0

14 بند

جدول 2 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم real time PCR لفيروس عائلة كابريبوكس يتوافق مع اجهزة روش 1429 تجهيزات مخبرية Capripox Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: Real-time qPCR kit for detection of Capripox virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman applcation) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 1 0
طقم real time PCRلفيروس مرض جدري الأغنام يتوافق مع اجهزة شركة روش 1429 تجهيزات مخبرية Sheep Pox Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: Real-time qPCR kit for detection of sheep pox virus contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 2 0
طقم rt PCR لفيروس مرض التهاب الجلد العقدي يتوافق مع اجهزة شركة روش ABI BioRad 1429 تجهيزات مخبرية LSD Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: Real-time qPCR kit for detection of Lumpy Skin Disease virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 3 0
طقم Real time RT qPCR لفيروس مرض طاعون المجترات الصغيرة يتوافق مع اجهزة شركة ABI 1429 تجهيزات مخبرية PPR Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of peste des petit ruminant virus contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 4 0
طقم rtqPCR لفيروس مرض اللسان الأزرق يتوافق مع اجهزة شركة روش ABI BioRad 1190 تجهيزات مخبرية BTV Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Blue Tongue Virus(all serotypes) contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control Endogenous control PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 5 0
طقم real time RT qPCR لفيروس كورونا الجمال متلازمة الشرق الأوسط التنفسية 4571 تجهيزات مخبرية MERS Corona Virus Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of two different MERS Corona virus targets (upE and orf1a) contains all reagents and controls for the specific detection of MERS Corona Virus (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 6 0
طقم rtqPCR لفيروس مرض السعار يتوافق مع اجهزة شركة روش ABI BioRad 925 تجهيزات مخبرية Rabies Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection ofRabies virus, contains all reagents and controls :(contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control Endogenous control PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 7 0
طقم rtpcr لمرض حمى الوادي المتصدع يتوافق مع أجهزة شركة ABI 925 تجهيزات مخبرية RVF Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Rift Valley Fever virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 8 0
طقم rtpcr لمرض حمى الثلاث أيام يتوافق مع أجهزة شركة ABI 714 تجهيزات مخبرية BEF Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Bovine ephemoral Fever virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 9 0
طقم real time RT qPCR لفيروس انفلونزا الخيول H7N7 يتوافق مع اجهزة شركة روش ABI BioRad 476 تجهيزات مخبرية Eqine Influenza (H7N7) Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for specific detection of Eqine Influenza virus serotype (H7N7) contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 10 0
طقم real time RT qPCR لفيروس انفلونزا الخيول H3N8 يتوافق مع اجهزة شركة روش ABI BioRad 476 تجهيزات مخبرية Eqine Influenza (H3N8) Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for specific detection of Eqine Influenza virus serotype (H3N8) contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 11 0
طقم rt qPCR لفيروس مرض طاعون الخيل يتوافق مع اجهزة شركة روش ABI BioRad 1429 تجهيزات مخبرية AHS Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of African Horse Sickness virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 12 0
طقم rtPCR لفيروس مرض التهاب الشرايين في الخيول يتوافق مع اجهزة شركة روش ABI BioRad 1190 تجهيزات مخبرية EVA Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Equine Viral Arterities virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 13 0

13 بند

جدول 3 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCRلفيروس مرض النيوكاسل ماتريكس جين يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 1429 تجهيزات مخبرية NDV Real-Time PCR Detection kit ( Matrix gene) compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of New Castel Disease virus ( Matrix gene)contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 1 0
طقم rtPCRلفيروس مرض النيوكاسل F gen يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 1429 تجهيزات مخبرية NDV Real-Time PCR Detection kit ( F gene) compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of New Castel Disease virus (F gene)contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls).The kit allows simultaneous differentiation and quantification of common live vaccine strains and the more pathogenic field strain of Newcastle Disease Virus. Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 2 0
طقم rtPCRلفيروس مرض ا التهاب الشعب الهوائية عترة OX يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 1429 تجهيزات مخبرية IBV QX Strain Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of QX Strain of Infectioua bronchitis virus ,contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 3 0
طقم rtPCRلفيروس مرض التهاب الشعب الهوائية عترة مغايرة يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 1429 تجهيزات مخبرية IBV Variant Strain Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of variant strain of Infectioua bronchitis virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 4 0
طقم rtPCRلفيروس مرض الجمبورو يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 1429 تجهيزات مخبرية IBDV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Infectious bursal disease virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target., 100 tests, Supply with quality control certificate and validation report data. اختبار 5 0

5 بند

جدول 4 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCR لفيروس مرض انفلونزا الطيور النوع أ ام 2 يتوافق مع اجهزة شركة روش و ABI 3810 تجهيزات مخبرية Avian Influenza ( Matrix gene) Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A Matrix gene contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 1 0
طقم rtPCR لفيروس مرض انفلونزا الطيور للجين اتش 9 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 3810 تجهيزات مخبرية Avian Influenza subtype H9 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H9 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 2 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش 5 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 2852 تجهيزات مخبرية Avian Influenza subtype H5 Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A subtypeH5 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 3 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان 1 يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 1429 تجهيزات مخبرية Avian Influenza subtype N1 Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N1 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 4 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان6 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 714 تجهيزات مخبرية Avian Influenza subtype N6 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N6 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 5 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان8 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 1429 تجهيزات مخبرية Avian Influenza subtype N8 Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N8 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with اختبار 6 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان2 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 2381 تجهيزات مخبرية Avian Influenza subtype N2 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N2 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 7 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين ان7 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 714 تجهيزات مخبرية Avian Influenza subtype N7 Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A subtype N7 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 8 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش9 ان2 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 2857 تجهيزات مخبرية Avian Influenza subtype H9N2 Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H9N2 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 9 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش5 ان6 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 2857 تجهيزات مخبرية Avian Influenza subtype H5N6 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H5N6 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 10 0
طقم rtPCRلفيروس مرض انفلونزا الطيور للجين اتش7 ان9 يتوافق مع اجهزة شركة روش وأجهزة شركة ABI 1429 تجهيزات مخبرية vian Influenza subtype H7N9 Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of Avian Influenza type A subtype H7N9 contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control ,PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to . 10 copies of target, Supply with quality control certificate and validation report data. اختبار 11 0

11 بند

جدول 5 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات وبروب لفيروس مرض النيوكاسل ماتركس جين يتوافق مع اجهزة شركة روش و ABI و BIORAD 476 تجهيزات مخبرية بادئات وبروب لفيروس مرض النيوكاسل ماتركس جين يتوافق مع اجهزة شركة روش و ABI و BIORAD Primers & Probe with positive Control for Newcastle disease virus Matrix gene. - validated and verified - quantiative and qualitative. اختبار 1 0
بادئات فيروس مرض الليكوزس في الطيور العام 25 نانومول 2 تجهيزات مخبرية primers for avian leukosis (general) (25 nanomol): ALV ALL-F 5-CGAGTGGCTCGCGAGATGG-3 ALV ALL-R 5-ACACTACATTTCCCCCTCCCTAT-3 طقم 2 0
بادئات فيروس مرض الليكوزس في الطيور ايه 25 نانومول 2 تجهيزات مخبرية primers for avian leukosis (A) (25 nanomol): ALV A-F 5-GGCTTAGGCCAAAAGGGGT-3 ALV A-R 5-GTGCATTGCCACAGCGGTACTG-3 طقم 3 0
بادئات فيروس مرض الليكوزس في الطيور بي 25 نانومول 2 تجهيزات مخبرية primers for avian leukosis (B) (25 nanomol): ALVB -F 5-GGCTTTACCCCATACGATAG-3; ALVB -R 5-ACACATCCTGACAGATGGACCA-3 طقم 4 0
بادئات فيروس مرض الليكوزس في الطيور إي 25 نانومول 2 تجهيزات مخبرية primers for avian leukosis (E) (25 nanomol): ALVE -F 5-GGCTTCGCCCCACTCCAA-3; ALVE-R 5-GCACATCTCCACAGGTGTAAAT-3 طقم 5 0
بادئات فيروس مرض الليكوزس في الطيور جيه 25 نانومول 2 تجهيزات مخبرية primers for avian leukosis (G) (25 nanomol): ALVJ-F 5-GGATGAGGTGACTAAGAAAG-3; ALVJ-R 5-CGAACCAAAGGTAACACACG-3 طقم 6 0
بادئات فيروس مرض الجمبورو العام 25 نانومول 2 تجهيزات مخبرية primers for Gumboro (general) (25 nanomol): IBDV- F 5’- GCCCAGAGTCTACACCAT -3/IBDV-R 5’- CCCGGATTATGTCTTTGA -3 With positive control, each 25 nmol طقم 7 0
بادئات فيروس مرض الجمبورو الضاري مع الضابط الإيجابي 25 نانومول 14 تجهيزات مخبرية primers for Gumboro (virulent strain) (25 nanomol): IBDVv -F 5’- CCGAGGCCACAGATAACCTTAAA -3’; IBDVv -R 5’- CCTCTAAACGGGTTGAAC -3’ With positive control, each 25 nmol. طقم 8 0
بادئات لفيروس مرض الريو في الطيور 25 نانومول 2 تجهيزات مخبرية primers for avian Reovirus infections (25 nanomol): Reovirus -F 5’- ATTACGCAGAGGCATTT -3’; Reovirus -R 5’-CCCACTGCCGAATACA -3’ طقم 9 0
بادئات فيروس مرض أنيميا الدجاج 25 نانومول 2 تجهيزات مخبرية Primers for chicken anaemia virus (25 nanomol): CAV- F 5’-GCAGTA GGT ATA CGC AAG GC -3’ /CAV- R 5’-CTG AACACC GTT GAT GGT C -3’ طقم 10 0
بادئات فيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 25 نانومول 2 تجهيزات مخبرية primers for infectious laryngotracheitis virus in poultry (25 nanomol): ILTV – F 5’-CTCTTCCTCCTCTTCCTCAT -3 ; ILTV – R 5’-GTTACTGACTGAACCGACCC -3 طقم 11 0
بادئات للكشف عن فيروس النزيف الدموي في الأرانب 25 نانومول 2 تجهيزات مخبرية primers for Rabbit hemorrhagic disease virus (RHDV) (25 nanomol): RHDV-F -5-CCACCACCAACACTTCAGGT -3 –/ RHDV- R –5- CAGGTTGAACACGAGTGTGC -3 – طقم 12 0
بادئات للكشف عن فيروس تدني انتاج البيض في الدجاج 25 نانومول 2 تجهيزات مخبرية primers for Egg drop syndrome virus (EDS) (25 nanomol): EDS- F 5 – ttctgtcaccgataaaggt -3 / EDS-R 5 -agttattccaaatgggcat -3 طقم 13 0
بادئات فيروس الادينوفيرس 25 نانومول 2 تجهيزات مخبرية Primers for Adeno virus (25 nanomol): FAV -F 5- ccctcccaccgcttacca-3 ; FAV -R 5 cacgttgcccttatcttgc -3 طقم 14 0
بادئات فيروس جدري الطيور 25 نانومول 2 تجهيزات مخبرية Primers for Fowl Pox virus (25 nanomol): FPV -F 5’-ACG-ACC-TAT-GCG-TCT-TC-3 ; FPV-R 5’-ACG-CTT-GAT-ATC-TGG-ATG-3 طقم 15 0
بادئات فيروس الالتهاب الرعاش في الدجاج 25 نانومول 2 تجهيزات مخبرية Primers for AvianEncephlo myeilitis virus (25 nanomol): AEV -F 5’CTTATGCTGGCCCTGATCGT-3 ; AEV-R 5’-TCCCAAATCCACAAACCTAGCC-3 طقم 16 0

16 بند

جدول 6 المواد - توريد مستلزمات طبية

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCR لبكتيريا مرض الحمى المجهولة يتوافق مع اجهزة روش وأي بي أي وبيوراد اطقم تفاعل بلمرة لتشخيص أمراض بكتيرية 1426 تجهيزات مخبرية Real Time PCR kit for detection of Q-fever compatible with Roche ,ABI and Biorad systems.• Kit with reagents for the detection of Coxiella burnetii. • It contains: • specific primer/probe mix (120 reactions).- Positive control template RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data اختبار 1 0
طقم rtPCR للكشف عن بروسيلا أبورتس يتوافق مع اجهزة روش وأي بي أي وبيوراد 952 تجهيزات مخبرية Real Time PCR kit FOR detection of Brucella abortus compatible with Roche, ABI and Biorad systems• Kit with reagents for the quantitative detection of Brucella abortus DNA. It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data اختبار 2 0
طقم rtPCR للكشف عن بروسيلا ميليتنسيس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1238 تجهيزات مخبرية Real Time PCR kit FOR detection of Brucella miletensis compatible with Roche, ABI and Biorad systems• Supply Kit with reagents for the quantitative detection of Brucella miletensis DNA. It contains: • specific primer/probe mix.- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix. Supply with control certificate and validation report data اختبار 3 0
طقم rtPCR للمايكوباكتيريوم باراتيوبركيولوسيس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1238 تجهيزات مخبرية Real Time PCR kit FOR detection of Mycobacterium pratuberculosis compatible with ABI and Biorad systems.• Kit with reagents for the detection of Mycobacterium paratuberculosis.•It contains: • specific primer/probe mix.- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data اختبار 4 0
طقم rtPCR للكشف عن مرض الرعام في الفصيلة الخيلية يتوافق مع اجهزة روش وأي بي أي وبيوراد 429 تجهيزات مخبرية rtPCR kit for detection of glanders in equines: - It includes all needed components and contains: - TagMan fast advanced master., 100 tests - IPC primers and probe. - TagMan oligonucleotide probes. - Oligonucleotide sense and antisense primers. B. mallei: fliP forw (5´-3´): CCC ATT GGC CCT ATC GAA G flip rev (5´-3´): GCC CGA CGA GCA CCT GAT T flip probe: FAM-CAG GTC AAC GAG CTT CAC GCG GAT C-TAMRA B. pseudomallei complex: aroA forw (5´-3´): CCG CTC GTG AAG GCG AAG aroA rev (5´-3´): CGC CAT CAG CTT GAT CGT GA aroA probe: FAM -CGA GCG TCG TCG AGA TCG-TAMRA - Autoclaved ultrapure water. - Controls and any other required items for the test. اختبار 5 0
طقمrtPCR لمرض خناق الخيل يتوافق مع اجهزة روش وأي بي أي وبيوراد 429 تجهيزات مخبرية rtPCR kit FOR detection of Strept equi- specific primer/probe mix.- Positive control template.- RNAse/DNAse free water.- Template preparation buffer., 100 tests The kit should be provided with the suitable qPCR mastermix. Supply with control certificate and validation report data اختبار 6 0
طقم rtPCR لبتوسبيرا يتوافق مع اجهزة روش وأي بي أي وبيوراد 286 تجهيزات مخبرية Real Time.PCR kit for detection of Leptospira species compatible with ABI and Biorad systems.• It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data ., 100 tests إختبار 7 0
طقم rtPCR للكشف عن مايكوباكتيريوم بوفس في حيوانات المزرعة يتوافق مع اجهزة روش وأي بي أي وبيوراد 286 تجهيزات مخبرية Real time PCR kit FOR detection of Mycobacterium bovis in animals compatible with Roche, ABI and Biorad systems. It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix., 100 testsSupply with control certificate and validation report data إختبار 8 0
طقم rtPCRللكلاميدوفيلا ابورتس يتوافق مع اجهزة روش وأي بي أي وبيوراد 1429 تجهيزات مخبرية Real Time PCR kit for detection of Chlamydophila abortus compatible with Roche ABI and Biorad systems.• RT.PCR kit for detection of Chlamydophila abortus. It contains: • specific primer/probe mix .- Positive control template.- RNAse/DNAse free water.- Template preparation buffer.• The kit should be provided with the suitable qPCR mastermix.Supply with control certificate and validation report data اختبار 9 0
طقم ملتيبلكس بي سي أر للكشف عن البروسيلا وتحديد أنواعها طقم 24 تفاعل 11 تجهيزات مخبرية Multiplex conventional PCR for brucella spp. The kit allows detecting and differentiating the brucellae affecting farm animals: B.melitensis, B.abortus, B.suis and B.ovis and the RB51, B19 and Rev1 vaccines. Kit content: Mixture A ( specific primers for Brucella), Mixture B (enzyme mixture), Positive Control A1 – (C+ of Amplification B.Suis), Positive Control A2 (C+ of Amplification RB51), Positive Control A3 (C+ of Amplification Rev 1). Kit/24 reaction. طقم 10 0
كاشف بريمكس بى سى أر بوكيت المركزي للكشف عن كوكسيلا بيرنتي 24 أختبار للطقم 14 تجهيزات مخبرية Pockit Central PCR PREMIX Reagent for detection of Coxiella burnettii High sensitivity and specificity Kit 24 reactions طقم 11 0
كاشف بريمكس بي سى آر بوكيت المركزي للكشف عن كلاميديا ابورتس 14 تجهيزات مخبرية Pockit Central PCR Premix for detection of Chlamydia abortus High sensitivity and specifucity Kit 24 reaction طقم 12 0
كاشف بريمكس بى سى آر بوكيت المركزي للكشف عن مايكوباكتيريم بارا تيوبر كلوسيس 14 تجهيزات مخبرية Pockit Central PCR Premix for detection of Mycobacterium paratuberculosis High sensitivity and specifucity Kit 24 reaction طقم 13 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن البروسيلا ابورتس 24 اختبار طقم 48 تجهيزات مخبرية Pockit Central PCR PREMIX REAGENT PCR for detection of Brucella abortus, High sensitivity and specificity. Kit/24 reaction طقم 14 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن البروسيلا مليتنسيس 24 اختبار طقم 48 تجهيزات مخبرية Pockit Central PCR PREMIX REAGENT PCR for detection of Brucella melitenses, High sensitivity and specificity, Kit/24 reaction طقم 15 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن بكتيريا السالمونيلا 24 اختبار طقم 12 تجهيزات مخبرية Pockit Central PCR PREMIX REAGENT PCR for detection of Salmonella spp, High sensitivity and specificity, Kit/24 reaction طقم 16 0

16 بند

جدول 7 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لمرض الحمى القلاعية ضد البروتين غير البنائي 3ABC في الأبقار والأغنام ويفرق بين المحصن والمصاب طبيعيا 4762 تجهيزات مخبرية ELISA kit for detection of antibodies against Nonstructural proteins of FMD (3ABC) and differentiate between naturally infected (+3ABC) and vaccinated animals. Detects antibodies against nonstructural proteins (3ABC) of FMD virus in serum or plasma from bovine and ovine Differentiate between naturally infected and vaccinated animals (bovine, ovine).High sensitivity and specificity Internationally validated. 5 plates/ kit اختبار 1 0
طقم اليزا للكشف عن انتيجينات فيروس مرض الحمى القلاعية 1429 تجهيزات مخبرية ELISA for detection of FMD virus and serotyping of FMD O, A, ASIA 1, SAT1, SAT2 and C. Detects antigens of FMD virus. High sensitivity and specificity. Internationally validated. 5 plates (10 tests/plate) اختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الحمى القلاعية ضد البروتين البنائية النوع O 4762 نشرة علمية Solid-Phase Competitive ELISA (SPCE) for Antibodies Specific to FMDV serotypes O,Detects antibodies against structural proteins of FMD virus type O. High sensitivity and specificity. Internationally validated. 5 plates اختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الحمى القلاعية ضد البروتين البنائية النوع A 4762 نشرة علمية Solid-Phase Competitive ELISA (SPCE) for Antibodies Specific to FMDV serotypes A,Detects antibodies against structural proteins of FMD virus type A. High sensitivity and specificity. Internationally validated. 5 plates اختبار 4 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الحمى القلاعية ضد البروتين البنائية النوع SAT2 4762 نشرة علمية Solid-Phase Competitive ELISA (SPCE) for Antibodies Specific to FMDV serotypes SAT2, Detects antibodies against structural proteins of FMD virus type SAT2. High sensitivity and specificity. Internationally validated. 5 plates اختبار 5 0
طقم اليزا تنافسية للكشف عن الأجسام المضادة لمرض طاعون المجترات الصغيرة 2381 تجهيزات مخبرية C-ELISA for detection of antibodies against Peste des Petitis ruminants. Competitive Elisa Detects antibodies against PPR in serum or plasma of goat and sheep. High sensitivity and specificity Internationally validated. 4 plates / kit اختبار 6 0
طقم اليزا للكشف عن انتجين فيروس طاعون المجترات الصغيرة في صغار المجترات 714 تجهيزات مخبرية Immuno-capture ELISA for detection of PPR virus in small ruminants. Immuno-capture sandwich Elisa. Allows rapid identification of PPR antigen in swabs from lesions, tears, and tissue samples. High sensitivity and specificity Internationally validated. 2 plates / Kit اختبار 7 0
طقم اليزا للكشف عن الأجسام المضادة لمرض اللسان الأزرق 2857 تجهيزات مخبرية C- ELISA for detection of antibodies against blue tongue in animals. • Competitive Elisa. The kit is able to detect specific BTV antibody in serum and plasma of sheep, goats, cattle, buffalo, deer, and others High sensitivity and specificity Internationally validated. 5 plates / Kit اختبار 8 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لفيروس مرض الانيميا المعدي في الخيول 2381 تجهيزات مخبرية Equine Infectious Anemia double antigen. Detects Antibodies against EIA in serum of horses. 5 plate. High sensitivity and specificity. Internationally validated. اختبار 9 0
مشخصات لفحص الأجسام المناعية ضد فيروس انيميا الخيل المعدي باستخدام اختبار كوجين 2381 تجهيزات مخبرية Agar gel immunodiffusion (AGID) kit; Coggins Test for the detection of EIA antibodies in equine serum and plasma: The kit contains reference antigen and reference antisera (positive and negative) and agar gel for EIA AGID. 200 test/kit. اختبار 10 0
طقم اليزا للكشف عن الاجسام المضادة لمرض طاعون الخيل الفيروسي 4762 تجهيزات مخبرية ELISA for detection of antibodies against AHS. blocking Elisa for detection of antibodies against African horse sickness (AHSV) in horse serum High sensitivity and specificity Internationally validated. 2 plates / Kit. اختبار 11 0
طقم اليزا للكشف عن الاجسام المضادة لمرض التهاب الشرايين الفيروسي في الخيول 2381 تجهيزات مخبرية Equine Infectious Anemia double antigen. Detects Antibodies against EIA in serum of horses. 5 plate. High sensitivity and specificity. Internationally validated. اختبار 12 0
طقم اليزا للكشف عن الاجسام المضادة النوع IgG لمرض حمى غرب النيل في الخيول 2381 تجهيزات مخبرية ELISA for the detection of specific IgG antibodies to WNV in birds and equine serum samples.. 5 plate. High sensitivity and specificity. Internationally validated. اختبار 13 0
طقم اليزا للكشف عن الاجسام المضادة النوع IgM لمرض حمى غرب النيل في الخيول 2381 تجهيزات مخبرية ELISA for the detection of specific IgM antibodies to WNV in birds and equine serum samples.. 5 plate. High sensitivity and specificity. Internationally validated. اختبار 14 0
طقم اليزا تنافسية للكشف عن الأجسام المضادة لمرض حمى الوادي المتصدع 9524 تجهيزات مخبرية Rift Valley Fever Competition Multi-species ELISA kit. able to detect antibodies in serum sample of diff. spp. including ruminants, camels, horses, dogs and others 10 plates High sensitivity and specificity. Internationally validated اختبار 15 0
طقم اليزا للكشف عن الاجسام المضادة النوع أي جى إم لمرض حمى الوادي المتصدع 2381 تجهيزات مخبرية Immuno-capture ELISA for the detection of IgM antibodies against RVF. Detects IgM Antibody for RVFV nucleoprotein in serum of bovine, caprine and ovine. 5 plates. High sensitivity and specificity. Internationally validated. اختبار 16 0

16 بند

جدول 8 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع A 5486 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع أ Indirect ELISA for detection of antibodies against influenza type A the kit is able to detect antibodies in serum of birds (multispecies) Quantitative.High sensitivity and specificity Internationally validated.5 plates…12×8 –well -strip.Supply with control certificate and validation report data إختبار 1 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع H5 914 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع(H5) . Indirect ELISA for detection of antibodies against influenza type A subtype H5 the kit is able to detect antibodies in serum of birds (multispecies) Quantitative. High sensitivity and specificity Internationally validated. 2 plates…12×8 –well -strip. Supply with control certificate and validation report data. إختبار 2 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع H9 914 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع(H9) Indirect ELISA for detection of antibodies against influenza type A subtype H9 the kit is able to detect antibodies in serum of birds (multispecies) Quantitative. High sensitivity and specificity Internationally validated. 2 plates…12×8 –well strip Supply with control certificate and validation report data. إختبار 3 0
طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع H7 914 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لفيروس مرض انفلونزا الطيور النوع (H7). Indirect ELISA for detection of antibodies against influenza A subtype H7 the kit is able to detect antibodies in serum of birds (multispecies) Quantitative. High sensitivity and specificity Internationally validated. 2 plates…12×8 –well strip Supply with control certificate and validation report data إختبار 4 0
طقم اليزا للكشف عن الاجسام المضادة لمرض النيوكاسل 10971 تجهيزات مخبرية طقم اليزا للكشف عن الاجسام المضادة لمرض النيوكاسل ELISA for detection of antibodies against NDV.Indirect ELISA for detecting antibodies against Newcastle disease in poultry(multispecies). Quantitative. 5 plates…12×8 –well strip. High sensitivity and specificity. Supply with control certificate and validation report data. إختبار 5 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الالتهاب الشعب الهوائية المعدي في الطيور 10971 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض الالتهاب الشعب الهوائية المعدي في الطيورIndirect ELISA for sero-diagnosis of Infectious bronchitis in poultry (multispecies). The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated.Supply with control certificate and validation report data. إختبار 6 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الجمبورو المعدي في الدجاج 10971 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض الجمبورو المعدي في الدجاجIndirect ELISA for sero-diagnosis of Infectious bursal disease in chickenThe kit is able to detect antibody in bird's serum Quantitative.5 plates…12×8 –well stripHigh sensitivity and specificity.Internationally validated.Supply with control certificate and validation report data. إختبار 7 0
طقم اليزا للكشف عن الأجسام المضادة لمرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 10971 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور Indirect ELISA kit for detection of Antibody against infectious Laryngeotracheitis (ILT) virus. The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated. Supply with control certificate and validation report data. إختبار 8 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الشلل الرعاش الوبائي في الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض الشلل الرعاش الوبائي في الطيور Indirect ELISA kit for detection of Abs against Avian Encephalomyeilitis virus. The kit is able to detect antibody in bird's serum. Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated.Supply with control certificate and validation report data. إختبار 9 0
طقم اليزا للكشف عن الأجسام المضاده لمرض الريو في الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضاده لمرض الريو في الطيور Indirect ELISA kit for detection of antibodies against Reovirus infection in birds. The kit is able to detect antibody in birds serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated. Supply with control certificate and validation report data. إختبار 10 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الأدينوفيرس فى الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض الأدينوفيرس فى الطيور Indirect ELISA kit for Antibody Detection against (FADV) Group 1 Avian Adenovirus The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validated.Supply with control certificate and validation report data إختبار 11 0
طقم اليزا للكشف عن الاجسام المضادة لمرض تدني البيض في الطيور 2286 تجهيزات مخبرية طقم اليزا للكشف عن الاجسام المضادة لمرض تدني البيض في الطيور Indirect ELISA for detection of antibodies against Egg Drop SyndromeDetects antibodies against EDS in chicken.Quantitative. 5 plates.High sensitivity and specificity Internationally validated. إختبار 12 0
طقم اليزا للكشف عن الأجسام المضادة لمرض انيميا الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض انيميا الطيور Indirect ELIAS kit for serodiagnosis of Chicken Infectious Anemia The kit is able to detect antibody in bird's serum Quantitative. 5 plates…12×8 –well stripHigh sensitivity and specificity.Internationally validated.Supply with control certificate and validation report data إختبار 13 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس في الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس في الطيورIndirect ELIAS kit for detection of antibodies against Avian Leukosis. Detects antibody against ALV subgroup A,B,C,E in serum sample. Quantitative. 5 plates…12×8 –well stripHigh sensitivity and specificity. Internationally validated. Supply with control certificate and validation report data إختبار 14 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس نوع J في الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن الأجسام المضادة لمرض الليكوزس نوع J في الطيور Indirect ELISA kit for detection of Avian Leukosis virus antibody subgroup J. detect antibody against subgroup J in serum sample. Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validatedSupply with control certificate and validation report data إختبار 15 0
طقم اليزا للكشف عن أنتجن P27 مرض الليكوزس في الطيور 1143 تجهيزات مخبرية طقم اليزا للكشف عن أنتجن P27 مرض الليكوزس في الطيور Direct ELISA kit for detection of Avian Leukosis virus Antigen P27. Able to detect antigen in cloacal swab, albumin, and serum sample.Quantitative. 5 plates…12×8 –well strip High sensitivity and specificity. Internationally validatedSupply with control certificate and validation report data. إختبار 16 0

16 بند

جدول 9 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة لمرض الحمى المجهولة في الحيوانات طقم طبقين 9143 تجهيزات مخبرية Indirect ELISA for detection of antibodies against Q fever in animals (multispp.) Detection of antibody against Q fever in ruminants and camel. High sensitivity and specificity Supply with control certificate and validation report data. 2 plates / kit. إختبار 1 0
طقم اليزا للكشف ومعايرة الأجسام المضادة لفيروس السعار 952 تجهيزات مخبرية ELISA for detection and titration of IgG anti-rabies virus glycoprotein in animal sera and plasma,High sensitivity and specificity. Internationally validated. 2 plates اختبار 2 0
طقم اليزا قابض للأنتجين للكشف عن بكتيريا كلوستريديوم بيرفرنجنز وسمومها الفا وبيتا وابسلون فى الحيوانات طقم 2 طبق 95 تجهيزات مخبرية ELISA for detection of Cl. Perfringens and its toxins (alpha, beta and epsilon) in intestinal contents of animals. Able to detect Cl. Perfringens cells and its toxins in intestinal contents of animals. High sensitivity and specificity. Internationally validated. 2 plates / Kit (96 tests) طقم 3 0
طقم اليزا للكشف عن الاجسام المضادة لبكتيريا مرض الكلاميديا ابورتس في الاغنام والماعز طقم طبقين 13714 تجهيزات مخبرية Indirect ELISA for detection of antibodies against Chlamydophilla abortus For the detection of antibodies against Chlamydophila abortus in serum and plasma of ruminants. 2 plates / kit. High sensitivity and specificity. Internationally validated اختبار 4 0
طقم اليزا للكشف عن الأجسام المضادة لبكتيريا مرض نظير السل مرض جون في الحيوانات 13714 تجهيزات مخبرية Indirect ELISA for detection of antibodies against M. paratuberculosis in animals. Able to detect antibodies in serum and plasma of ruminant (ovine, caprine, bovine and camel). High sensitivity and specificity. Internationally validated. 5 plates / Kit (format 12*8 –well strip). اختبار 5 0
طقم اليزا غير مباشرة للكشف عن الاجسام المضادة لمرض الالتهاب الرئوي البلوري في الماعز طقم 5 طبق 6583 0 Indirect ELISA for detection of antibodies against Mycoplasma capricolum subspcapripneumoniae. For the detection of antibodies against CCPP in serum and cattle.5 plate / kit. High sensitivity and specificity. Internationally validated إختبار 6 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لبكتيريا مرض الالتهاب الرئوي البلوري في الماعز طقم 5 أطباق 9143 0 C- ELISA for detection of antibodies againstMycoplasma capricolum subspcapripneumoniae. For the detection of antibodies against CCPP in serum and cattle. 5 plates / kit. High sensitivity and specificity. Internationally validated إختبار 7 0
طقم اليزا تنافسية للكشف عن الاجسام المضادة لمرض الالتهاب الرئوي البلوري في الابقار طقم 5 أطباق 5486 0 C- ELISA for detection of antibodies against Mycoplasma mycoides subsp mycoides. For the detection of antibodies against CBPP in serum and cattle. 5 plates / kit. High sensitivity and specificity. Internationally validated إختبار 8 0
اختبار لاتكس كامبيلوباكتر 571 0 latex agglutination test for campylobacter species Including control positive and control negative اختبار 9 0
إختبار انتجين ملون روز بنغال للكشف عن الأجسام المناعية المضادة للبروسيلا 95 0 #REF! #REF! 10 0
طقم اختبار تثبيت المتممة CFT للكشف عن مرض الرعام في الخيول 19 تجهيزات مخبرية Complement fixation test (CFT) to detect Glander disease in horse, 100-120 reactions. VERONAL BUFFER CALCIUM MAGNESIUM (pH 7.2). ANTIGEN (A protein Suspension of Burkholderia mallei) 10ml t320 (VABUR002981). CONTROL SERA ( positive and negative) negative could be prepared by the lab. positive sera: Serum Burkholderia.mallei POZ, 5ml (VSEBU001973). Freeze-dried Guinea-pig, 5ml complement ( c ) CPLT 2X5ml. Sheep erythrocytes AT 50% (RBC): (VSE-410). Rabbit hemolytic anti-RBG serum (heamolysin H). Disposable microplates (96 well round U bottomed) with lid or cover (plastic or adhesive) enough for the No. of kit reactions. Including all reagents and materials طقم 11 0
إحتبار انتجين ملون للكشف عن الأجسام المضادة لبكتيريا سالمونيلا ساينوفي 29 0 Mycoplasma synoviae stained antigen coloured antigen for plate agglutination test. 10 ml (200 test). Provided with positive and negative control serum (1 ml) with each kit. عبوة 12 0
إختبار انتجين ملون للكشف عن ألاجسام المناعية المضادة لبكتيرا سالمونيلا قاليسبتكم 29 0 Mycoplasma gallisepticum stained antigen. coloured antigen for plate agglutination test. 10 ml (200 test). Provided with positive and negative control serum (1 ml) with each kit. عبوة 13 0
إختبار انتجين ملون للكشف عن ألاجسام المناعية المضادة لبكتيريا سالمونيلا بلورم 29 0 Salmonella pullorum stained antigen coloured antigen for plate agglutination test. 50 ml (1000 test). Provided with positive and negative control serum (1 ml) with each kit. عبوة 14 0
إختبار الحلقى للكشف عن الأجسام المناعية المضادة للبروسيلا فى الحليب 14 0 Milk Ring Test for detection of antibodies against brucellae in milk samples. عبوة 15 0

15 بند

جدول 10 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا مليتنسيس في الضأن والماعز طقم 5 أطباق 13714 تجهيزات مخبرية Indirect ELISA for detection of antibodies against B. mellitensis in small ruminants. • Elisa for detection of antibodies against Br. mellitensis in sheep and goat serum • High sensitivity and specificity. • Internationally validated. • 5 plates اختبار 1 0
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا ابورتس فى الابقار 6857 تجهيزات مخبرية Indirect ELISA for detection of antibodies against Brucella abortus in cattle • Elisa for detection of antibodies against B. abortus in cattle serum and plasma • High sensitivity and specificity. • Internationally validated.• 5 plates اختبار 2 0
طقم اليزا تنافسية للكشف عن الأجسام المناعية المضادة لبكتيريا بروسيلا ملتنسيس في الحيوانات ضأن ماعز ابقار ابل طقم طبقين 6857 تجهيزات مخبرية Competitive ELISA for detection of antibodies against B. mellitensis in animals.• A competitive elisa for detection of antibody against B. mellitensis in animals.• High sensitivity and specificity. • Internationally validated.• 2 plates اختبار 3 0
طقم اليزا تنافسية للكشف عن الأجسام المناعية المضادة المضادة للبروسيلا في مصل الدم والبلازما 2743 تجهيزات مخبرية Competive ELISA for detection of antibodies against Brucellae in serum and plasma of animals and differentiation between infected and cattle vaccinated with Brucella abortus strain 19. طقم اليزا تنافسية للكشف عن الأجسام المناعية المضادة المضادة للبروسيلا في مصل الدم والبلازما وقادر على التفريق بين الأبقار المحصنة بلقاح بروسيلا ابورتس العترة 19 اختبار 4 0
إختبار اليزا للكشف عن الأجسام المناعية المضادة لبكتيريا ليبتوسبيرا 595 تجهيزات مخبرية ELISA for detection of antibodies against Leptospira spp. For the detection of antibodies against leptospira spp. in serum and plasma of animals including sheep and cattle. one plate / kit. High sensitivity and specificity. Internationally validated اختبار 5 0
طقم اليزا للكشف عن الأجسام المضادة لبكتيريا مرض رعام الخيل 4937 تجهيزات مخبرية Double antigen ELISA for the detection of antibodies directed against Burkholderia mallei in serum or plasma from horses, donkeys, mules. 2 plates/kit. High sensitivity and specificity. • Internationally validated. اختبار 6 0
طقم اليزا للكشف عن الاجسام المضادة لمرض اللستريا في الحيوانات طقم طبق 1371 تجهيزات مخبرية ELISA for detection of antibodies against Listeria spp in animals. For the detection of antibodies against Lesteriosis in serum of animals. 1 plate / kit. High sensitivity and specificity. إختبار 7 0
طقم اليزا للكشف عن الأجسام المضادة لمرض الخناق في الخيول طقم طبقين 1371 تجهيزات مخبرية Elisa Test Kit for the detection of antibodies against Strangles in horses. Detects Antibody in serum of horses against the bacteria causing strangles . 2 plates / kit. High sensitivity and specificity. Internationally validated إختبار 8 0
طقم اليزا للكشف عن الأجسام المناغية المضادة لبكتيريا كورايني بتكتيريم سودوتيوبركلوسيس فى الضان والماعز 2286 تجهيزات مخبرية طقم اليزا للكشف عن الاجسام المضادة لمرض السل الكاذب فى الأغنام Indirect ELISA for detection of antibodies against Peudotuberculosis in sheep . High sensitivity and specificity إختبار 9 0
طقم اليزا للكشف عن الاجسام المضادة للمايكوبلازما اجالاكشي فى المجترات طقم طبقين 595 تجهيزات مخبرية ELISA for detection of antibodies against Mycoplasma agalactiae For the detection of antibodies against Mycoplasma agalactiae in serum and plasma of ruminants. 2 plates / kit. High sensitivity and specificity. Internationally validated إختبار 10 0
طقم اليزا انترفيرون للكشف عن الاجسام المضادة لمرض السل البقري في الابقار طقم طبقين 1429 مشخص Gamma- interferon ELISA kit for detection of antibodies against bovine TB. A sandwich ELISA for the detection of ovine, bovine, caprine and buffalo interferon gamma (IFN-g), which is produced in response to previous animal contact with the bacterium. High sensitivity and specificity. The kit should be supplied with bovine and avian PPD and all needed reagents. Supplied with control certificate and validation report data. kit/2 plates (192 reaction) إختبار 11 0
طقم اليزا للكشف عن الأجسام المضادة لمرض السل في الابقار طقم5 أطباق 2286 مشخص Elisa Test Kit for the detection of antibodies against bovine tuberculosis in cattle. Detects Antibody in serum of cattle against Mycobacterium bovis . 5 plates / kit. High sensitivity and specificity. Internationally validated إختبار 12 0
طقم اليزا للكشف عن الاجسام المضادة للبروسيلا فى حليب الحيوانات 3429 تجهيزات مخبرية Indirect ELISA for detection of antibodies against Brucella in milk of animals • High sensitivity and specificity. • Internationally validated.• 5 plat / kit اختبار 13 0

13 بند

جدول 11 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم اليزا للكشف عن مرض السرا تربانوسوما ايفانساي بالخيل طقم طبقين 19 تجهيزات مخبرية ELISA kit for detection of Surra in equines, 2 plates/kit Contains: Antigen (RoTat 1.2VSG) Conjugate (Protein A-PO 1mg SIGMA Lot 106H8280 ELISA Plate (Nunc Maxisorp). PBS-0.01M.PH7.4 PBS-Blotto 0.01M.PH7.4 PBS-sucrose 0.01M.PH7.4 PBS-Tween 0.01M.PH7.4 ABTS-buffer Substrate solution (ABTS-Tablet) طقم 1 0
طقم اليزا للكشف عن الأجسام المضادة لمرض التوكسوبلازما في الحيوانات 24 تجهيزات مخبرية Indirect ELISA for detection of antibodies against Toxoplasma gondii multispecies. Detects antibodies against Toxoplasma in serum and plasma in animals. High sensitivity and specificity. Internationally validated. 2 Plates/ kit. طقم 2 0
طقم اليزا للكشف عن الاجسام المضادة لمرض البابيزيا في الخيول 14 تجهيزات مخبرية Competitive ELISA (cELISA) for detection of antibodies against Babesia caballi in horse. 2 plates/kit طقم 3 0
طقم اليزا للكشف عن الاجسام المضادة لمرض الثايليريا في الخيول 14 تجهيزات مخبرية Competitive ELISA (cELISA) for detection of antibodies against Theileria equi horse. 2 plates/kit طقم 4 0
إختبار تثبيت المتممة لتشخيص مرض الدورين شامل كل المكونات 24 تجهيزات مخبرية Complement fixation test (CFT) to detect Dourine (Trypanosoma equiperdium) disease in horse, 100-120 reactions. VERONAL BUFFER CALCIUM MAGNESIUM (pH 7.2). ANTIGEN (A protein Suspension of Trypanosoma equiperdium) 10ml t320 (VABUR002981) CONTROL SERA : Low Titre, High Titer and Negative (positive and negative) positive sera: Serum Trypanosoma equiperdium POZ, 5ml (VSEBU001973) Freeze-dried Guinea-pig, 5ml complement ( c ) CPLT 2X5ml Sheep erythrocytes AT 50% (RBC): (VSE-410). Rabbit hemolytic anti-RBG serum (heamolysin H). Disposable microplates (96 well round U bottomed) with lid or cover (plastic or adhesive) enough for the No. of kit reactions. Including all reagents and materials طقم 5 0
اختبار كات لتشخيص مرض التربانوسوما 7143 تجهيزات مخبرية CATT test (Card Agglutination Test for Trypanosomiasis) Test kit containing all reagents and accessory materials + protocol. 250 test/kit. Freeze dried reagents (antigen, controls). اختبار 6 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن الثايليريا ليستوكواردي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 476 تجهيزات مخبرية Real time PCR kit for Theileria lestoquardi. - Theileria lestoguardi specific primer/probe mix. - SPV positive control template. - RNAse/DNAse free water. - Template preparation buffer. The kit should be provided with the suitable qPCR mastermix. اختبار 7 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل التوكسوبلازما يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 476 تجهيزات مخبرية Real time PCR kit for detection of Toxoplasma spp. - Toxoplasma spp. specific primer/probe mix. - positive control template. - RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. اختبار 8 0
طقم بى سي ار ذو الوقت الحقيقى للكشف عن طفيل تربانوسوما اكويبرديم مع اجهزة روش آي بىآي 952 تجهيزات مخبرية طقم بي سي آر للكشق عت طفيل تربانوسوما إكوبرديم شامل كل المكونات و يتوافق مع أجهزة روش ,بيوراد وأى بي آي Real Time PCR for detection of Trypanosoma equiperdium اختبار 9 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن تريبانوسوما ايفانساي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 952 تجهيزات مخبرية طقم بي سي ار ذو الوقت الحقيقي للكشف عن تريبانوسوما ايفانساي يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Trypanosoma evansi. - Trypanosoma evansi specific primer/probe mix. - SPV positive control template. - RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. اختبار 10 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل البابيزيا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 476 تجهيزات مخبرية طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل البابيزيا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد Real time PCR kit for detection of Babesia spp. - Babesia spp specific primer/probe mix. - positive control template. - RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. اختبار 11 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل الانابلازما يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 476 تجهيزات مخبرية Real time PCR kit for detection of Anaplasma spp. - Anaplasma spp. specific primer/probe mix. - positive control template. - RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. اختبار 12 0
طقم بي سي ار ذو الوقت الحقيقي للكشف عن طفيل الكوكسيديا يتوافق مع اجهزة شركة روش وأي بي أي وبيوراد 476 تجهيزات مخبرية Real time PCR kit for detection of Coccidia spp. - Coccidia spp. specific primer/probe mix. - positive control template. - RNAse/DNAse free water. - Template preparation buffer The kit should be provided with the suitable qPCR mastermix. اختبار 13 0
انتجين اليزا للكشف عن التريباناسوما في الخيل 5 مادة مخبرية Pan-Trypanosoma whole cell lysate antigen for ELISA (lyophilized) each tube for one plate عبوة 14 0

14 بند

جدول 12 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
اختبار لاتكس للكشف عن السالمونيلا 9524 تجهيزات مخبرية اختبار لاتكس للكشف عن السالمونيلا latex agglutination test for detection of salmonella (Oxoid) • Can be used for presumptive identification of Salmonella isolated on selective agar plates. 100 test/kit إختبار 1 0
إختبارلاتكس للكشف عن ألأي كولاي 7462 تجهيزات مخبرية اختبار لاتكس للكشف عن الاي كولاي latex agglutination test for detection of E.coli • Can be used for presumptive identification of Salmonella isolated on selective agar plates. 100 test/kit إختبار 2 0
اختبار لاتكس للكشف عن الاي كولاي O 157 4762 تجهيزات مخبرية اختبار لاتكس للكشف عن الاي كولاي latex agglutination test for detection of E.coli o157 • Can be used for presumptive identification of Salmonella isolated on selective agar plates. 100 test/kit إختبار 3 0
اختبار لاتكس للكشف عن استافيلوكوكاس أوريس 4762 تجهيزات مخبرية اختبار لاتكس للكشف عن استافيلوكوكاس أوريس latex agglutination test for detection of Staphylococcus aureus • Can be used for presumptive identification of Salmonella isolated on selective agar plates. 100 test/kit إختبار 4 0
اختبار لاتكس كامبيلوباكتر جيوجيني 4762 تجهيزات مخبرية latex agglutination test for campylobacter jujeni 100 TEST Include control positive and control negative اختبار لاتكس كامبيلوباكتر جيوجيني إختبار 5 0
اختبار لاتكس كلوستريديوم بيرفرنجنس 3810 تجهيزات مخبرية latex agglutination test for clostridium perfringens 100 TEST Include control positive and control negative اختبار لاتكس كلوستيريديوم بيرفرنجنس إختبار 6 0
اختبار لاتكس للكشف عن الأجسام المناعية المضادة لبكتيريا مرض الالتهاب الرئوي البلوري فى الماعز 3810 تجهيزات مخبرية Latex agglutination test for serodiagnosis of CCPP • 2 ml reagent. Negative and positive control. Reaction slides. 20 disposable droppers Internationally validated. إختبار 7 0
إختبار لاتكس للكشف عن الأجسام المناعية المضادة لبكتيريا مض الألتهاب الرئوي البللوري فى الأبقار 1905 تجهيزات مخبرية Latexagglutination for serodiagnosis of CBPP .2 ml reagent.Negative and positive controls. Reaction slides. 20 disposable droppers Internationally validated إختبار 8 0
اختبار لاتكس ليستيريا مونوستوجنس 4762 تجهيزات مخبرية latex agglutination test for listeria monocytogenes 100 TEST Include control positive and control negative اختبار لاتكس ليستيريا مونوستوجنس إختبار 9 0
بروتين التريبانوسوما لتشخيص السرة 5 مادة مخبرية Trypanosoma Evansi (Surra) Antigen (RoTat 1.2VSG) عبوة 10 0
مصل مضاد للغلوبولين المناعي للخيول مربوط مع الانزيم 7 مادة مخبرية (Anti-Horse IgG (whole molecule)−Peroxidase antibody produced in rabbit (Sigma A6917-1ML). عبوة 11 0
اطباق اليزا ماكسيسورب 10 مستلزمات Nunc-Immuno MicroWell 96 well solid plates M9410-1CS Pack of 60 plates صندوق 12 0
طقم اليزا للكشف عن الأجسام المضادة لمرض طفيل الثايليريا 1829 مشخصات مخبرية Indirect ELISA for detection of antibodies againstTheileria annulata. Detects antibodies against the parasite in serum and plasma of ruminants High sensitivity and specificity. Internationally validated. 2 Plates/ kit. إختبار 13 0
طقم اليزا للكشف عن الأجسام المضادة لمرض طفيل الانابلازما في الحيوانات 1829 مشخصات مخبرية Indirect ELISA for detection of antibodies against Anaplasma spp. Detects antibodies against the parasite in serum and plasma of animals High sensitivity and specificity. Internationally validated. 2 Plates/ kit. إختبار 14 0
طقم اليزا للكشف عن انتجين فيروسات روتا وكورونا والاي كولاى والكربتوسبوريديم فى روث الابقار طقم96 اختبار 1097 مشخصات مخبرية Immuno-capture ELISA for detection of Rota and Corona viruses, E. coli and Cryptosporidium in bovine Immuno-capture ELISA that is able to detect Rota and Corona viruses, E. coli and Cryptosporidium in bovine (in one strip). Internationally validated. One plate / kit. إختبار 15 0

15 بند

جدول 13 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم فايتيك 2 للتعرف على البكتيريا موجبة جرام عبوة 20 167 تجهيزات مخبرية طقم فايتيك 2 للتعرف على البكتيريا موجبة جرام (عبوة / 20) VITEK2 ID FOR GP Bacteria (GP cards) طقم 1 0
طقم فايتيك 2 للتعرف على البكتيريا سالبة جرام عبوة 20 357 تجهيزات مخبرية طقم فايتيك 2 للتعرف على البكتيريا سالبة جرام (عبوة / 20) VITEK2 ID FOR GN Bacteria (GN cards) طقم 2 0
طقم فايتيك 2 للتعرف على البكتيريا اللاهوائية عبوة 20 36 تجهيزات مخبرية طقم فايتيك 2 للتعرف على البكتيريا اللاهوائية (عبوة / 20) Vitek 2 ID For anaerobic bacteria (ANC cards طقم 3 0
طقم فايتك حساسية البكتيريا موجبة الجرام للمضادات الحيوية 95 تجهيزات مخبرية طقم فايتك حساسية البكتيريا موجبة الجرام للمضادات الحيوية (عبوة / 20) Vitek 2 AST cards for detection of antibiotic sensitivity of gram positive bacteria VETERINARY طقم 4 0
طقم فايتك حساسية البكتيريا سالبة الجرام للمضادات الحيوية 357 تجهيزات مخبرية طقم فايتك حساسية البكتيريا سالبة الجرام للمضادات الحيوية (عبوة / 20) Vitek 2 AST cards for detection of antibiotic sensitivity of gram Negative bacteria VETERINARY طقم 5 0
أنابيب بوليستيرين سعة 5 ملليتر لجهاز فايتك2 71 تجهيزات مخبرية أنابيب بوليستيرين سعة 5 ملليتر لجهاز فايتك2 VITEK UNSENSITIZED TUBES 12 X 75 MM FOR VITEK ID & AST TESTS 2000 أنبوبة / كيس كيس 6 0
محلول ملحى معقم 5 4 الى 7 لجهاز فايتك2 57 تجهيزات مخبرية محلول ملحى معقم 4.5 الى 7 لجهاز فايتك2 Nacl- pH 4.5-7.0 for VITEK 12 / BOX عبوة 7 0
طقم معايرة العكارة لجهاز الفايتك Densichek Vitek2 10 تجهيزات مخبرية buffers for calibration of denistik of vitek طقم 8 0
طقم فايتك 2 للتعرف على بكتيريا كوراينى 29 مشخص طقم فايتك للتعرف على بكتيريا كوارينى Vitek 2 cards for identification of Corynebacteria CBC cards طقم 9 0
طقم فايتك للتعرف على البكتيريا العصوية 29 مشخص طقم فايتك ف 2 للتعرف على البكتيريا العصوية Vitek 2 BCL cards for identification of bacilli طقم 10 0
طقم فايتك 2 للكامبيلوباكتر NH 105 تجهيزات مخبرية طقم فايتك للكامبيلو باكتر (عبوة / 20) NH VITEK2 ID FOR Campylobacter طقم 11 0

11 بند

جدول 14 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أنابيب مخبرية لجهاز بي سي ار ABI 76 تجهيزات مخبرية انابيب مخبرية لجهاز بي سي ار API MicroAmp Fast Reaction Tube With Cap, 0.1 ML (1000) حبة 1 0
شرائط مخبرية لجهاز بي سي ار ABI 76 تجهيزات مخبرية شرائط مخبرية لجهاز بي سي ار API MicroAmp Fast 8-Tube Strip, 0.1 ML حبة 2 0
اغطية شرائط لجهاز بي سي ار ABI 76 تجهيزات مخبرية اغطية شرائط لجهاز بي سي ار API MicroAmp Optical 8-cap Strips حبة 3 0
غطاء اطباق لجهاز بي سي ار ABI 76 تجهيزات مخبرية غطاء اطباق لجهاز بي سي ار API MicroAmp™ Optical Adhesive Film (100 film) حبة 4 0
رؤوس بلاستيكية معقمة بفلتر 0 5 10 ميكرون 190 تجهيزات مخبرية رؤوس بلاستيكية معقمة بفلتر 0.5- 10 ميكرون Sterile tips with filters (0.5-10 µl) Standard Sterile – plugged – 96 per package حبة 5 0
رؤوس بلاستيكية معقمة بفلتر 2 100ميكرون 190 تجهيزات مخبرية رؤوس بلاستيكية معقمة بفلتر 2 - 100ميكرون Sterile tips with filters (2-100 ul) Standard Sterile – plugged – 96 per package حبة 6 0
رؤوس بلاستيكية معقمة بفلتر 100 1000 ميكرون 190 تجهيزات مخبرية رؤوس بلاستيكية معقمة بفلتر 100- 1000 ميكرون sterile pipette tips filtered (100- 1000 µl) 96 tips per package حبة 7 0
رؤوس بلاستيكية معقمة بفلتر 30 300 ميكرون 238 تجهيزات مخبرية رؤوس بلاستيكية معقمة بفلتر 100- 1000 ميكرون sterile pipette tips filtered (30- 300 µl) 96 tips per package حبة 8 0
رؤوس ماصات بلاستيكية زرقاء 100 1000 ميكرون 500 حبةكيس 48 تجهيزات مخبرية رؤوس بلاستيكية 100- 1000 ميكرون Blue pipette tips (100- 1000 µl) 500 tips per package عبوة 9 0
أطباق معقمة شفافه 96 سعة 500 ميكرو للعينات 48 تجهيزات مخبرية أطباق معقمة شفافه 96 سعة 500 ميكرو للعينات Sterile micrtiterplates (500 microliters ) 96 wells طبق 10 0
روؤس ماصات بلاستيكية صفراء 286 تجهيزات مخبرية روؤس ماصات بلاستيكية صفراء (200-300 ميكروليتر )Yellow micropipette tips (200 microliter) كيس 11 0
ماصة أتوماتيكية ذات ثمانية قنوات مع الحامل 8 5 50 ميكروليتر 34 مستلزمات تشخيصية ماصة أتوماتيكية ذات ثمانية قنوات (5- 50 ميكرو) مع الحامل 8-multichannel pipette (5-50 ul) 8-channel- High accuracy and precision ensure reliable pipetting results- Accuracy: up to ±2.0 to 8.0%  -   Precision: ≤0.6 to 4.0% حبة 12 0
ماصة أتوماتيكية ذات ثمانية قنوات مع الحامل 8 50 200 ميكروليتر 34 مستلزمات تشخيصية ماصة أتوماتيكية ذات ثمانية قنوات (50- 200 ميكرو) مع الحامل 8-multichannel pipette (50-200 ul) 8–channel- High accuracy and precision ensure reliable pipetting results- Accuracy: up to 5.0% to 1.0±  -   Precision: up to  2.0 to 0.3% حبة 13 0
ماصة أتوماتيكية ذات ثمانية قنوات مع الحامل 8 1000 100 ميكروليتر 34 مستلزمات تشخيصية ماصة أتوماتيكية ذات ثمانية قنوات (1000- 100 ميكرو) مع الحامل 8-multichannel pipette (100-1000) 8–channel- High accuracy and precision ensure reliable pipetting results- Accuracy: up to ±1.4 to 4.0%-   Precision: ≤0.6 to 1.5% حبة 14 0
ماصات بلاستكية معقمة مفردة 5 ملليتر 4286 مستلزمات تشخيصية ماصات بلاستكية معقمة مفردة 5 ملليتر Sterile plastic pipettes graduated individually rapped 5 ml حبة 15 0
رؤوس بلاستيكية معقمة بفلتر 01 1 ميكرون 190 تجهيزات مخبرية رؤوس بلاستيكية معقمة بفلتر 0.1- 1 ميكرون sterile tips with filters (0.1-1 µl) Sterile – plugged – 96 per package حبة 16 0

16 بند

جدول 15 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
زيت العدسة الزيتية للفحص المجهري 48 تجهيزات مخبرية زيت العدسة الزيتية للفحص المجهري Immersion Oil for Microscopy: Refractive index (n 20/D): 1.515 - 1.517 Density (d 20 °C/ 4 °C): 1.0245 - 1.0265 عبوة 1 0
طقم مولد غاز لزراعة البكتريا اللاهوائية 71 تجهيزات مخبرية طقم مولد غاز لزراعة البكتريا اللاهوائية (عبوة/ 10 ظروف). Anaerobic gas generating kit. عبوة 2 0
طقم مولد غاز لزرع بكتيريا كامبيلوباكتر 333 تجهيزات مخبرية طقم مولد غاز لزرع بكتيريا كامبيلوباكتر (صندوق/10 ظروف) Campylobacter gas generating kits (10/box حبة 3 0
سلك زرع بلاتيني حلقي لزراعة البكتيريا 48 تجهيزات مخبرية سلك زرع بلاتيني حلقي لزراعة البكتيريا Platinum wire loop for cultivation of bacteria. - Pack 25 piece حبة 4 0
حامل لسلك الزرع البكتيري الحلقي 48 تجهيزات مخبرية حامل لسلك الزرع البكتيري الحلقيAluminum Loop Holder with PVC Handle حبة 5 0
أكياس جهاز تجانس العينات قابلة للتعقيم 48 تجهيزات مخبرية أكياس جهاز تجانس العينات , قابلة للتعقيم (250 حبة/صندوق) Stomacher bags with different sizes autoclavable .(100 ml and 400 ml capacity) (250/box) كيس 6 0
انابيب بي سي أر صغيرة 29 تجهيزات مخبرية انابيب بي سي أر صغيرة (0,2 مل) (500 حبة/كيس) PCR micro- tubes (0.2 ml) Polypropylene- colorless tube- RNase and DNase free- capacity 0.2 mL- cap (Lid كيس 7 0
طقم ماصات رقمية متغيرة بقناة واحدة مجموعة احجام مختلفة مع الحامل 26 تجهيزات مخبرية طقم ماصات رقمية متغيرة بقناة واحد مجموعة احجام مختلفة مع الحامل Adjustable Single channel micropipette Set of six with a bench stand. stainless steel piston, PVDF (a plastic with very high resistance to chemicals) handle, Equipped with a dual position tip-ejector, Autoclavable, Superior accuracy and reproducibility: adjustable-volume 0.2-2 µl micropipette, adjustable-volume 1-10 µl micropipette, adjustable-volume 2-20 µl micropipette, adjustable-volume 20-100 µl micropipette, adjustable-volume 50-200µl micropipette, adjustable-volume 200-1000 µl micropipette طقم 8 0
سرنجة معقمة 2 مل 24 تجهيزات مخبرية سرنجة معقمة 2 مل (100 حبة/كرتونة) Sterile disposable Syringe 2 ml حبة 9 0
سرنجة معقمة 5 مل 24 تجهيزات مخبرية سرنجة معقمة 5 مل (100 حبة/كرتونة) Sterile disposable Syringe 5 ml حبة 10 0
سرنجة معقمة 20 مل 24 تجهيزات مخبرية سرنجة معقمة 20 مل (100 حبة/كرتونة) 20 ml Sterile disposable Syringe. حبة 11 0
سلك الزرع البكتيري الحلقي احادي الاستعمال مفرد معقم 47619 تجهيزات مخبرية سلك الزرع البكتيري الحلقي احادى الاستعمال مفرد معقم Bacteriological wire loop with handle disposable. 10μL Flexible- disposable- sterile- individually sealed حبة 12 0
حامل أنابيب اختبار سعة 60 أنبوب 38 تجهيزات مخبرية حامل انابيب اختبار سعة 60 انبوب Tube rack for 60 tubes 20 mm diameter حبة 13 0
أطباق بتري بلاستكية معقمة 14286 تجهيزات مخبرية Petridish Plastic sterile. Carton/ 500 plate اطباق بتري بلاستكية معقمة طبق 14 0
انابيب كرايو سعة 3مل بحوامل 95 تجهيزات مخبرية انابيب كرايو سعة 3 مل مع صندوق حفظ لمائة أنبوبة (صندوق / 100حبة) Cryotubes (3ml) with 100 tube rack Noncytotoxic raw materials added sample security and tubes certified free of Dnase and RNase for genomic applications self-standing tubes for ease of use on the bench top حبة 15 0

15 بند

جدول 16 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
حامل أكياس الاستوماشر BAG RACK 24 تجهيزات مخبرية حامل أكياس الاستوماشر Stomacher 400C Blending Bag Rack, Holds 10 Bag حبة 1 0
غشاء تصفية للاي كولاي 29 تجهيزات مخبرية Microbial Escherichia coli MCE Sterile filter membrane 100 / boxغشاء تصفية للاي كولاي حبة 2 0
مشبك أكياس استوماشر 48 تجهيزات مخبرية مشبك أكياس استوماشر Stomacher Blender Bag Clips, Fits All Stomacher Blender Bags, 200/cs حبة 3 0

3 بند

جدول 17 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
ماصات بلاستيكيه ذات الاستخدام الواحد 9524 تجهيزات مخبرية Disposable plastic Pipette 10 ml sterile حبة 1 0
محلول جهاز المالدي توف بايوتايبر 5 تجهيزات مخبرية HCCA Buffer for MALDI TOF BIOTYBER 10 / BOX طقم 2 0
محلول بي تي اس لجهاز المالدي توف بايوتايبر 1 تجهيزات مخبرية BTS for MALDI TOF BIOTYBER 10 / BOX طقم 3 0

3 بند

جدول 18 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن السالمونيلا 38 تجهيزات مخبرية real time RT- qPCRkit for detection of Salmonella -Contains primer/probe mix for 96 reactions. - internal control set mix for 96 reactions. - Positive control lyophilized sample - PCR grade water - Master Mix (containing all PCR constituents essential for the rt PCR reaction. - contain extraction set طقم 1 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن الكلوستريديوم بيرفرنجنس 33 تجهيزات مخبرية real time RT- qPCRkit for detection of clostridium perfringens -Contains primer/probe mix for 96 reactions. - internal control set mix for 96 reactions. - Positive control lyophilized sample - PCR grade water -Master Mix (containing all PCR constituents essential for the rt PCR reaction. - contain extraction set طقم 2 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن الاي كولاي o 157 14 تجهيزات مخبرية real time RT- qPCRkit for detection of e.coli o157 -Contains primer/probe mix for 96 reactions. - internal control set mix for 96 reactions. - Positive control lyophilized sample -PCR grade water -Master Mix (containing all PCR constituents essential for the rt PCR reaction. - contain extraction set طقم 3 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن الاي كولاي 14 تجهيزات مخبرية real time RT- qPCRkit for detection of e.coli -Contains primer/probe mix for 96 reactions. - internal control set mix for 96 reactions. - Positive control lyophilized sample - PCR grade water - Master Mix (containing all PCR constituents essential for the rt PCR reaction. - contain extraction set طقم 4 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن الليستيريا مونوسيتوجنس 24 تجهيزات مخبرية real time RT- qPCRkit for detection of listeria monocytogens -Contains primer/probe mix for 96 reactions.- internal control set mix for 96 reactions.- Positive control lyophilized sample -PCR grade water- Master Mix (containing all PCR constituents essential for the rt PCR reaction. - contain extraction set طقم 5 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن المكورات العنقودية الذهبية 14 تجهيزات مخبرية real time RT- qPCRkit for detection of staphylococcus aureus -Contains primer/probe mix for 96 reactions. -internal control set mix for 96 reactions.-Positive control lyophilized sample -PCR grade water -Master Mix (containing all PCR constituents essential for the rt PCR reaction.-contain extraction set طقم 6 0
طقم تفاعل البلمرة المتسلسل اللحظي للكشف عن الكامبيلوباكتر جيوجيني 19 تجهيزات مخبرية real time RT- qPCRkit for detection of campylobacter jejuni -Contains primer/probe mix for 96 reactions. - internal control set mix for 96 reactions. - Positive control lyophilized sample - PCR grade water - Master Mix (containing all PCR constituents essential for the rt PCR reaction. - contain extraction set طقم 7 0
طقم RTPCR لتأكيد وتحديد نوع السالمونيلا 95 تجهيزات مخبرية طقم RTPCR لتأكيد وتحديد نوع السالمونيلا qualitative, semi-automated real-time PCR test designed for the confirmation and typing of Salmonella. The confirmation procedure advances a suspected (presumptive) Salmonella result (according to ISO-6579- 1) to a confirmed Salmonella spp result or a Salmonella negative result. The typing procedure generates a serovar result or a “genovar” code both uniquely defining each bacterial isolate tested. Testing is performed after a simple sample preparation step of bacteria from culture. 48 TEST / KIT طقم 8 0

8 بند

جدول 19 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انابيب ابندورف 2 مل 4762 تجهيزات مخبرية انابيب ابندورف (2 مل) Eppendorf tubes(2ml( Polypropylene graduated microcentrifuge tube-with a flat cap. Certified RNase, DNase, and DNA free. Tested pyrogen free. Frosted side-writing surface. Easy opening cap has a beveled lip for comfort in repeated openings. حبة 1 0
انابيب ابندورف 1 5 مل 29 تجهيزات مخبرية انابيب ابندورف (1.5 مل) Eppendorf tubes(1.5ml( Polypropylene graduated microcentrifuge tube-with a flat cap. Certified RNase, DNase, and DNA free. Tested pyrogen free. Frosted side-writing surface. Easy opening cap has a beveled lip for comfort in repeated openings. ( 500 حبة) كيس 2 0
انابيب ابندورف 2 مل 43 تجهيزات مخبرية انابيب ابندورف 0.2 مل) Eppendorf tubes (0.2ml (polypropylene graduated microcentrifuge tube-with a flat cap. Certified RNase, DNase, and DNA free. Tested pyrogen free. Frosted side-writing surface. Easy opening cap has a beveled lip for comfort in repeated openings. ( 500 حبة) حبة 3 0
اكياس جهاز التعقيم حجم وسط 4762 تجهيزات مخبرية اكياس جهاز التعقيم حجم وسط Laboratory autoclave bags medium  size BIOHAZARD AUTOCLAVE BAGS size 61×76.2cm × volume 78L. Resists punctures, tears and leaks كيس 4 0
اكياس نفايات مختبر حجم وسط 4762 تجهيزات مخبرية أكياس نفايات مختبر حجم وسط Laboratory waste bags medium  size BIOHAZARD disposal bags 76×100cm×22micron.  Resists punctures, tears and leaks كيس 5 0
عبوة زجاجية 2 5 لتر ايثانول عالي النقاوة 36 تجهيزات مخبرية عبوة زجاجية 2,5 لتر ايثانول عالي النقاوة Absolute Ethyl alcohol extra pure عبوة 6 0
كاشف كيميائي عن كفاءة التعقيم 29 تجهيزات مخبرية كاشف كيميائي عن كفاءة التعقيم Steam Chemical Indicator Strips -Used to monitor all 121-134°C (250-273°F) gravity and vacuum-assisted steam sterilization cycles عبوة 7 0
كاشف حيوي عن كفاءة التعقيم بالبخار 29 تجهيزات مخبرية كاشف حيوي عن كفاءة التعقيم بالبخار Biological Indicators and Test Packs for 250°F/121°C Gravity and 270°F/132°C Vacuum Assisted Steam Sterilizers عبوة 8 0
عبوة زجاجية 2 5 لتر ايثانول عالي النقاوة 29 تجهيزات مخبرية عبوة زجاجية 2,5 لتر ايثانول عالي النقاوة Absolute Ethyl alcohol extra pure عبوة 9 0
أنابيب تجميد عينات سعة 2 ملليتر مع صناديق حفظ 10 في 10 76 تجهيزات مخبرية أنابيب تجميد عينات سعة 2 ملليتر مع صناديق حفظ (10 * 10) Cryotubes 2 ml with storage boxex (10X10) حبة 10 0
ميثانول عالى النقاوة عبوة 2 5 لتر 17 نشرة علمية Methanol high purity 2.5 liters ميثانول عالى النقاوة عبوة 2,5 لتر عبوة 11 0
ماصات بلاستيكية معقمة 10 ملليتر مدرجة 1429 نشرة علمية ماصات بلاستيكية معقمة 10 ملليتر Plaric pipettes sterile 10 ml graduatede ,individually rapped حبة 12 0
ماصات بلاستيكية معقمة 1 ملليتر مدرجة 1429 نشرة علمية ماصات بلاستيكية معقمة 1 ملليتر Plaric pipettes sterile 1 ml graduatede ,individually rapped حبة 13 0
مسحات غير قطنية معقمة غير قطنية 4286 تجهيزات مخبرية مسحات غير قطنية معقمة Sterile swabs مسحة 14 0
اكياس حفظ عينات بلاستيكية معقمة مخبرية 5417 تجهيزات مخبرية اكياس حفظ عينات يلاستيكية معقمة مخبرية ( 15X15 سم) Specimen Bags: Leak proof, plastic autoclavable, 200-250 ml capacity حبة 15 0

15 بند

جدول 20 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
وسط اجار دم الغنم جاهز 4762 تجهيزات مخبرية وسط اجار دم الغنم (جاهز) BLOOD AGAR (SHEEP): Enriched medium Agar that has been specifically formulated to give improved haemolytic reactions with sheep blood. طبق 1 0
وسط اجار الماكونكي جاهز 14286 تجهيزات مخبرية وسط اجار الماكونكي (جاهز) MacConkey agar A differential medium for the isolation of coliforms and intestinal pathogens in water, dairy products and biological specimens. طبق 2 0
وسط اجار الماكونكي مع السيربتول جاهز 1905 تجهيزات مخبرية وسط اجار الماكونكي مع السيربتول (جاهز) SORBITOL MacCONKEY AGAR: a selective and differential medium for the detection of Escherichia coli O157 طبق 3 0
وسط اجار البريلينت الأخضر جاهز 3333 تجهيزات مخبرية وسط اجار البريلينت الأخضر (جاهز) Brilliant green agar A selective medium for the isolation of salmonellae, other than Salmonella typhi طبق 4 0
وسط أكس إل دي جاهز 19048 تجهيزات مخبرية وسط أكس إل دي (جاهز) XLD agar A selective medium for the isolation of salmonellae and shigellae from clinical specimens and food. طبق 5 0
وسط انتقائي صلب لعزل الكامبيلوباكتر جاهز 6667 تجهيزات مخبرية وسط انتقائي صلب لعزل الكامبيلوباكتر (جاهز) CAMPYLOBACTER SELECTIVE AGAR. A selective medium, prepared from Campylobacter Agar Base, Preston Campylobacter Selective Supplement and lysed horse blood, for the selective isolation of Campylobacter jejuni and C. coli from human, animal, avian and environmental specimens طبق 6 0
وسط صلب لعد البكتيريا جاهز 4762 تجهيزات مخبرية أوساط G73مزرعية 1+B67 طبق 7 0
وسط بيرد باركر التفريقي لزراعة البكتيريا العنقودية جاهز 2857 تجهيزات مخبرية وسط بيرد باركر التفريقي لزراعة البكتيريا العنقودية (جاهز) Baird-Parker Agar Selective and differential medium for the isolation of staphylococcus. طبق 8 0
وسط المانيتول والملح التفريقي لزراعة البكتيريا العنقودية جاهز 2857 تجهيزات مخبرية وسط المانيتول والملح التفريقي لزراعة البكتيريا العنقودية (جاهز) MANNITOL SALT AGAR A selective medium for the isolation of presumptive pathogenic staphylococci. Most other bacteria are inhibited, with the exception of a few halophilic species. طبق 9 0
وسط الاجار المغذي جاهز 4286 تجهيزات مخبرية وسط الاجار المغذي (جاهز) Nutrient agar: A general purpose medium which may be enriched with up to 10% blood or other biological fluid. طبق 10 0
وسط مرق تتراثيونيت مع النوفوبيوسين جاهز 9524 تجهيزات مخبرية وسط مرق تتراثيونيت مع النوفوبيوسين (جاهز) MULLER-KAUFFMANN TETRATHIONATE-NOVOBIOCIN BROTH (MKTTn) Muller-Kauffmann Tetrathionate-Novobiocin Broth (MKTTn) is a selective enrichment medium for the isolation of Salmonella when used with Novobiocin Selective Supplement (SR0181). عبوه 11 0
وسط تي إس بي مع جليسرول 9524 تجهيزات مخبرية وسط تي إس بي مع جليسرول. TSB + 15% Glycerol solution, ready for use. 3 ml/tube عبوه 12 0
وسط رابابورت فاسيلياديس جاهز 14286 تجهيزات مخبرية وسط رابابورت فاسيلياديس (جاهز) Rappaport-Vassiliadis enrichment broth A selective enrichment broth for the isolation of salmonellae. 10 ml/tube عبوه 13 0
وسط آجار إختبار حساسية المضادات الحيوية جاهز 714 تجهيزات مخبرية وسط آجار إختبار حساسية المضادات الحيوية Antibiotic disks sensitivity test agar طبق 14 0
وسط أجار كولومبيا مع دم الغنم 7143 تجهيزات مخبرية وسط أجار كولومبيا مع دم الغنم COLUMBIA BLOOD AGAR -Columbia Agar supplemented with 5% defibrinated sheep blood - Used for the isolation and cultivation of non-fastidious and fastidious bacteria طبق 15 0

15 بند

جدول 21 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
وسط ماء الببتون المتعادل جاهز 21429 تجهيزات مخبرية وسط ماء الببتون المتعادل (جاهز) Buffered Peptone Water Broth - Enrichment Pouch with 225 mL Buffered Peptone Water Broth -32 per case - Pre-mixed enrichment pouches, providing the right blend of premium nutrients and additives to ensure optimal organism growth - Puncture-resistant pouch, ideal for many sample preparation and enrichment procedures. كيس 1 0
شوربة تريبتون صويا مع المضاد نوفوبيوسين 4762 تجهيزات مخبرية شوربة تريبتون صويا مع المضاد نوفوبيوسين Modified Tryptic Soy Broth with Novobiocin - For the selective enrichment of enterohemorrhagic E. coli (EHEC) in foods, specially meat and poultry products. - package of 6, 225 ml bottles, contains novobiocin أنبوبة 2 0
وسط تربتوز الصويا جاهز 4286 تجهيزات مخبرية وسط تربتوز الصويا (جاهز) Tryptic Soy Broth Tryptic Soy Broth is a general purpose highly nutritious liquid medium for the cultivation of a wide variety of fastidious and non-fastidious organisms, including both aerobes and anaerobes, although the latter may require anaerobic conditions عبوة 3 0
وسط آجار الفحم المعدل سيفوبيرازون ديوكسيكولات 7619 تجهيزات مخبرية وسط آجار الفحم المعدل سيفوبيرازون ديوكسيكولات mCCD (Modified charcoal cefoperazone deoxycholate) agar -A selective medium used for the isolation of Campylobacter species from a variety of samples. طبق 4 0
وسط بولتون السائل 7619 تجهيزات مخبرية وسط بولتون السائل BOLTON SELECTIVE ENRICHMENT BROTH A medium for the selective pre-enrichment of Campylobacter organisms in food samples. -225 ml bottle or pouches كيس 5 0
وسط انتقائي صلب لعزل اللستريا 4286 تجهيزات مخبرية وسط انتقائي صلب لعزل اللستريا (جاهز) Listeria Selective Agar A selective and diagnostic medium for the detection of Listeria monocytogenes طبق 6 0
وسط أجار انتقائي ألوا 4286 تجهيزات مخبرية وسط أجار انتقائي ألوا (جاهز) Listeria Selective Agar ALOA A selective and diagnostic medium for the detection of Listeria monocytogenes طبق 7 0
وسط ثايوجلايكوليت لزراعة البكتيريا الهوائية واللاهوائية الكشف عن التلوث 2857 تجهيزات مخبرية وسط ثايوجلايكوليت لزراعة البكتيريا الهوائية واللاهوائية (الكشف عن التلوث) THIOGLYCOLLATE MEDIUM USP A medium for the cultivation of both aerobic and anaerobic organisms in the performance of sterility tests. Only anaerobic jar is required for the isolation of anaerobes. 5ml/tube عبوة 8 0
وسط فريزر لعزل اللستيريا 4286 تجهيزات مخبرية وسط فريزر لعزل اللستيريا ML 225 Fraser broth Fraser Broth is a selective medium used for the secondary enrichment of Listeria monocytogenes and - WITH SUPPLEMENT Listeria spp., as described in ISO 11290-1:2017 كيس 9 0
وسط أجار انتقائي للكلوستريديوم بيرفرنجنس 2857 تجهيزات مخبرية وسط أجار انتقائي للكلوستريديوم بيرفرنجنس clostridium perfringens CHRM AGAR طبق 10 0
وسط أجار الدم بودرة 14 تجهيزات مخبرية وسط أجار الدم (بودرة) Blood agar base No. 2 Blood agar base powder for isolation of fastidious bacteria. 500gm/pack عبوة 11 0
وسط تربتوز الصويا بودرة 14 تجهيزات مخبرية وسط تربتوز الصويا (بودرة) Trypticase soya Broth: 500gm/pack عبوة 12 0
أجار آجار بودرة 500 جرام عبوة 6 تجهيزات مخبرية أجار آجار بودرة Agar (powder 500 gm) عبوة 13 0
وسط داعم أنتقائى لعزل بكتيريا ستربتوكوكس 3 تجهيزات مخبرية وسط داعم أنتقائى لعزل بكتيريا ستربتوكوكس Streptococcus selective supplement عبوة 14 0
وسط آجار ستريبتوكوكسس الإنتقائي 3 تجهيزات مخبرية وسط آجار ستريبتوكوكسس الإنتقائي ( Streptococcus selective Agar powder 500 gm / packing) عبوة 15 0
وسط أجار الماكونكي بودرة 57 تجهيزات مخبرية وسط أجار الماكونكي (بودرة) MacConkey agar base: 500gm/pack A differential solid medium for the identification of coliforms. عبوة 16 0

16 بند

جدول 22 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
وسط ماء الببتون المتعادل بودرة 81 تجهيزات مخبرية وسط ماء الببتون المتعادل (بودرة) Buffered peptone water powder A non-selective pre-enrichtment broth for Salmonella. 500gm/pack عبوة 1 0
وسط ماء الببتون بودرة 500 جرام 7 تجهيزات مخبرية وسط ماء الببتون (بودرة) Peptone water powder: A basal medium to which carbohydrates and indicator may be added for fermentation studies.500gm/pack عبوة 2 0
وسط أجار البريلينت الأخضر بودرة 7 تجهيزات مخبرية وسط أجار البريلينت الأخضر (بودرة) Brilliant green agar base (Kaufmann medium) A selective medium powder for the isolation of Salmonellae. 500gm/pack عبوة 3 0
وسط رابابورت فاسيلياديس بودرة 62 تجهيزات مخبرية وسط رابابورت فاسيلياديس (بودرة) Rappaport-Vassiliadis enrichment broth powder A selective enrichment broth for the isolation of salmonellae.500gm/pack عبوة 4 0
وسط أجار اختبار الحساسية للمضادات الحيوية بودرة 19 تجهيزات مخبرية وسط أجار اختبار الحساسية للمضادات الحيوية (بودرة) Diagnostic sensitivity test agar A solid medium for the antibiotic sensitivity testing. 500gm/pack عبوة 5 0
وسط آجار المرق المغذي بودرة 24 تجهيزات مخبرية وسط الاجار المغذي (بودرة) Nutrient agar base: 500gm/pack عبوة 6 0
وسط المرق المغذي بودرة 14 تجهيزات مخبرية وسط المرق المغذي (بودرة) Nutrient broth base: 500gm/pack عبوة 7 0
وسط أكس إل دي بودرة 62 تجهيزات مخبرية وسط أكس إل دي XLD agar powder A selective medium for the isolation of salmonellae and shigellae from clinical specimens and food. عبوة 8 0
وسط اجار الماكونكي مع السيربتول بودرة 14 تجهيزات مخبرية وسط اجار الماكونكي مع السيربتول بودرة SORBITOL MacCONKEY AGAR: a selective and differential medium for the detection of Escherichia coli O157 عبوة 9 0
شوربة تريبتون صويا مع المضاد نوفوبيوسين بودرة 14 تجهيزات مخبرية شوربة تريبتون صويا مع المضاد نوفوبيوسين Modified Tryptic Soy Broth with Novobiocin - For the selective enrichment of enterohemorrhagic E. coli (EHEC) in foods, specially meat and poultry products. - powder عبوة 10 0
وسط بولتون السائل بودرة 24 تجهيزات مخبرية وسط بولتون السائل BOLTON SELECTIVE ENRICHMENT BROTH A medium for the selective pre-enrichment of Campylobacter organisms in food samples. Powder عبوة 11 0
دم حصان متحلل 95 تجهيزات مخبرية دم حصان متحلل laked horse blood sterile - 50 ml أمبوله 12 0
دم غنم معقم 143 تجهيزات مخبرية دم غنم معقم sterile sheep blood sterile - 50 ml أمبوله 13 0
وسط أجار تي بي اكس 1905 تجهيزات مخبرية وسط أجار تي بي اكس TBX Agar (Tryptone Bile X-glucuronide Agar) Chromogenic Agar for the detection and enumeration of Escherichia coli in foodstuffs, animal food and water without further confirmation. E. coli colonies are coloured blue-green. طبق 14 0

14 بند

جدول 23 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
وسط أجار سفين جارد جاهز 1905 تجهيزات مخبرية وسط أجار سفين جارد جاهز Sven Gard medium used for phase 2 of H antigen طبق 1 0
وسط أجار جلوتاميت المعدل بالمعادن 1905 تجهيزات مخبرية وسط أجار جلوتاميت المعدل بالمعادن Mineral-Modified Glutamate Agar (MMGA) طبق 2 0
وسط آجار تربتكاز الصويا جاهز 952 تجهيزات مخبرية Trypticase Soya agar طبق 3 0
وسط آجار المكورات السبحية الأنتقائي 952 تجهيزات مخبرية Streptococcus selective agar طبق 4 0
وسط شوربة المخ والقلب 1905 تجهيزات مخبرية وسط آجار شوربة القلب والمخ (جاهز) Bain heart infusion agar A highly nutritious infusion medium recommended for the cultivation of streptococci, Neisseria and other fastidious organisms. انوبة 5 0
وسط أجار المخ والقلب 1905 تجهيزات مخبرية وسط آجار شوربة القلب والمخ (جاهز) Bain heart infusion agar A highly nutritious infusion medium recommended for the cultivation of streptococci, Neisseria and other fastidious organisms. طبق 6 0
داعم وسط شوربة بولتون 190 تجهيزات مخبرية داعم وسط شوربة بولتون bolton broth supplement عبوة 7 0

7 بند

جدول 24 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
شوربة زرع المايكوبلازما بودرة 2 تجهيزات مخبرية PPLO broth for cultivation of mycoplasma spp. (DIFCO): 500gm/pack عبوة 1 0
وسط صلب لزرع المايكوبلازما بودرة 2 تجهيزات مخبرية PPLO agar for cultivation of mycoplasma spp. (DIFCO): 500gm/pack عبوة 2 0
شوربة مستخلص الخميرة بودرة 2 تجهيزات مخبرية Yeast extract broth (DIFCO): 500gm/pack عبوة 3 0
بودرة الصوديوم بايروفيت 5 تجهيزات مخبرية Sodium pyruvate powder, For microbiological use. 25gm/pack عبوة 4 0
بنسلين 1000000 وحدة 14 تجهيزات مخبرية Penicillin vial (1000000 IU) عبوة 5 0
بودرة استات الثاليوم لزرع المايكوبلازما 25جم 5 تجهيزات مخبرية Thalium acetate powder:   Used in the laboratories as a selective element against gram-negative bacteria in selective media for the detection of mollicutes.  Pack/25 gm. عبوة 6 0
مصل الخيل المعقم لزرع المايكوبلازما 24 تجهيزات مخبرية Sterile horse serum for the isolation of mycoplasma.Donor Horse Serum is suitable for use in diagnostic assays, as a supplement in mycoplasma growth and assay media, sterilized by filtration. Bottle 100/ml عبوة 7 0
وسط جاهز لعزل المايكوبلازما كابرينموني 10 تجهيزات مخبرية Mycoplasma Experience Medium for Mycoplasma Capricolum subsp. Capripneumoniae (U.K): A solid isolation medium for M. capricolum subsp. Capripneumoniae on which colonies develop a red colouration over 7 days. Not selective - . Some likely contaminants can develop colouration more rapidly. Incubation atmosphere: ‘Anaerogen’ (Oxoid) عبوة/100 مل 8 0
وسط أجار البروسيلا جاهز 119 تجهيزات مخبرية Brucella agar with 5% defibrinated blood: A medium for the cultivation and isolation of Brucella. The formula includes casein peptone, meat peptone, NaCl, yeast extract, dextrose, sodium bisulfite and agar. طبق 9 0
وسط اجار فاريلس جاهز 71 تجهيزات مخبرية Farrell’s selective solid agar medium A selective medium for the cultivation and isolation of Brucella. The basal medium could be tryptycase soy agar, blood agar base, or Columbia agar in addition to the selective agents and serum. طبق 10 0
وسط صلب للبروسيلا بودرة 1 تجهيزات مخبرية Brucella Medium Base (Dehydrated):Isolate and cultivate Brucella with this medium when used with Brucella Selective Supplement (SR0083 or SR0209)500gm/pack عبوة 11 0
وسط داعم لعزل البروسيلا 5 تجهيزات مخبرية Brucella selective supplement (Oxoid): Contains the following antibiotics: Polymyxin B, Bacitracin, Cycloheximide, Nalidixic acid, Nystatin and Vancomycin عبوة 12 0
سيرم الخيل خالي من الاجسام المضادة للبروسيلا عبوة 100 مل 5 تجهيزات مخبرية Sterile Horse serum (Brucella antibody free) (500 ml /Bottle) عبوة 13 0
وسط ناقل ايمس دون جاركول 238 تجهيزات مخبرية Amies transport medium without charcoal عبوة 14 0
وسط ناقل ايمس مع جاركول 238 تجهيزات مخبرية Amies transport medium with charcoal عبوة 15 0
وسط كاري بلير الناقل جاهز 238 تجهيزات مخبرية CARY-BLAIR MEDIUM: A transport medium for Gram negative and anaerobic organisms. عبوة 16 0

16 بند

جدول 25 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
زجاجة مدرجة 250 مل 10 تجهيزات مخبرية Graduated bottles. Capacity 250 ml - Basic Material clear Glass, Shape Round, Mouth Wide, Screw capped Closure, autoclavable. ml 250 حبة 1 0
زجاجة مدرجة 500 مل 10 تجهيزات مخبرية Graduated bottles 500 ml. Capacity 500 ml - Basic Material clear Glass, Shape Round, Mouth Wide, Screw capped Closure , autoclavable حبة 2 0
زجاجة مدرجة 1000 مل 10 تجهيزات مخبرية Graduated bottles 1000 ml. Capacity 1000 ml - Basic Material clear Glass, Shape Round, Mouth Wide, Screw capped Closure Size GL45, autoclavable حبة 3 0
موزع أوساط سائلة قابل للتعقيم مع كامل ملحقاته 2 تجهيزات مخبرية Analog-adjustable bottle-top medium dispenser: - Autocalvable. - Dispensing volume: 0.5-25 ml> Provided with 5 adaptors to fit the different reagent bottles حبة 4 0
زجاجات ماكارتني بالغطاء صندوق100 حبة 2 تجهيزات مخبرية MacCartney bottles: Autoclavable. Neutral Glass. Leak-proof clear glass bottle. With aluminium screw cap with rubber liner. Pack Size : 1 X 100 bottle. Capacity about 30 ml. عبوه 5 0
قضيب زجاجي معكوف 7 تجهيزات مخبرية Bent glass rod Clear Borosilicate Glass Rod around 3.3, for spreading samples on agar surfaces in Petri dishes Size: diam. around 3-42 mm حبة 6 0
انابيب سحب عينات الدم بدون مانع تجلط صندوق50 حبة 48 تجهيزات مخبرية Vacutainer tubes without anticoagulant Containing no anticoagulant – used for collection of serum for selected chemistry tests as well as clotted blood for immunohematology – ABOUT 6 ml. fit for venipuncture sampling system which enables sampling directly into a sterile tube. حبة 7 0
انابيب سحب عينات الدم بمانع تجلط EDTA صندوق50 حبة 48 تجهيزات مخبرية Vacutainer tubes with EDTA Standard vacutainer sterile tubes Spray-coated with EDTA. حبة 8 0
ابر لانابيب جمع الدم صندوق 100 48 تجهيزات مخبرية Needles for vacutainer tubes for blood collection Needle Length: up to 3.175 cm. Suitable for the above needle holder. حبة 9 0
حامل ابر لانابيب جمع الدم صندوق50 حبة 10 تجهيزات مخبرية Needle holder for blood collection Suitable for the above vacutainer tubes, medical grade material and Latex free. حبة 10 0
قطبان مغنطيسية للتقليب 3 احجام مختلفة 5 تجهيزات مخبرية Magnetic rods for stirring of liquids. - 3 different sizes. - 4 from each size. حبة 11 0
دوارق مخروطية 500 مل 24 تجهيزات مخبرية Conical flasks (500 ml). Class A borosilicate glass With easy-to-read scale and large labeling field for easy marking in fired-on, highly durable, white ceramic. Uniform wall thickness distribution makes these flasks ideal for heating applications .Autoclavable.. حبة 12 0
دوارق مخروطية 1000مل 14 تجهيزات مخبرية دوارق مخروطية 1000 مل Conical flasks (1000ml). Class A borosilicate glass With easy-to-read scale and large labeling field for easy marking in fired-on, highly durable, white ceramic. Uniform wall thickness distribution makes these flasks ideal for heating applications .Autoclavable. حبة 13 0
دوارق مخروطية 2000 مل 14 تجهيزات مخبرية دوارق مخروطية 2000 مل Conical flasks (2000 ml). Class A borosilicate glass With easy-to-read scale and large labeling field for easy marking in fired-on, highly durable, white ceramic. Uniform wall thickness distribution makes these flasks ideal for heating applications .Autoclavable. حبة 14 0
دوارق مخروطية 5000 مل 10 تجهيزات مخبرية دوارق مخروطية 5000 مل Conical flasks (5000 ml). Class A borosilicate glass With easy-to-read scale and large labeling field for easy marking in fired-on, highly durable, white ceramic. Uniform wall thickness distribution makes these flasks ideal for heating applications .Autoclavable. حبة 15 0

15 بند

جدول 26 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
وحدة تعقيم بالترشيح للأوسط المزرعية كاملة مع جميع ملحقاتها شاملا أغشية الترشيح 1 تجهيزات مخبرية Complete liquid filtration system with all accessories: It is used for the sterilization of heat-sensitive mycoplasma liquids media. The system includes: - Stainless steel pressure filter holder for 90 mm membranes> - Suitable silicon tubes (autoclavable) with stainless steel tubes and rubber stoppers for 2 – 5 liters volume conical flasks and metal clips. - Suitable vacuum pump, Air filters. - Suitable Membrane filters size (0.2µm), size (0.4 µm) and a pre-filter (a pack /100 piece from each ( حبة 1 0
شرائط اختبار الاكسديز 50شريط عبوة 5 تجهيزات مخبرية Oxidase strips for identification of bacteria (50 strip/pack) عبوة 2 0
بتريفيلم لعد البكتيريا الهوائية 286 تجهيزات مخبرية بتريفيلم لعد البكتيريا الهوائية Petrifilm Rapid Aerobic Count Plate طقم 3 0
بتريفيلم لعد المجموعة المعوية 286 تجهيزات مخبرية بتريفيلم لعد المجموعة المعوية Petrifilm Enterobacteriaceae Count Plate طقم 4 0
بتريفيلم لعد المجموعة القولونية 238 تجهيزات مخبرية بتريفيلم لعد المجموعة القولونية Petrifilm Rapid Coliform Count Plate طقم 5 0
بتريفيلم لعد الاستافيلوكوكاس أوريس 238 تجهيزات مخبرية بتريفيلم لعد الاستافيلوكوكاس أوريس Petrifilm staph.express count plate طقم 6 0
بتريفيلم لعد الاي كولاي 286 تجهيزات مخبرية بتريفيلم لعد الاي كولاي Petrifilm Select E. coli Count Plate طقم 7 0

7 بند

جدول 27 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
مجموعة خرطوش أقراص مضادات حيوية مضادة للبكتيريا الموجبة لصبغة جرام 12 نوع 11 تجهيزات مخبرية Panels of Antibiotic sensitivity Discs against Gram positive bacteria (veterinary use) 12 different types of antibiotics حبة 1 0
مجموعة خرطوش أقراص مضادات حيوية مضادة للبكتيريا السالبة لصبغة جرام 12 نوع 11 تجهيزات مخبرية Panels of Antibiotic sensitivity Discs against Gram negative bacteria (veterinary use) 12 different types of antibiotics حبة 2 0
جهاز توزيع اقراص الحساسية 6 تجهيزات مخبرية Antibiotic disk dispenser For Use With 90mm diameter plates. 8 disk cartridges حبة 3 0

3 بند

جدول 28 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم صبغة جرام 4في 250 ملليتر 24 تجهيزات مخبرية طقم صبغة جرام Gram Stain Set طقم 1 0
طقم صبغة زيل نيلسين لصبغ البكتيريا الصامدة للاحماض طقم 250 مل 3 عبوات 17 مستلزمات تشخيصية Ziehl-neelsen stain kit for staining of acid-fast bacteria: Kit contents (250 ml each): Carbol fuchsin strong staining solution , Acid fast decolourizer, Methylene blue (lofflers) stain طقم 2 0
صبغة أزرق الميثلين عبوة500 مل 17 مستلزمات تشخيصية Methylene blue stain: Methylene Blue 1% Aqueous Solution (for Lab Use Only ) — 500 mL — with Convenient Dispensing Cap عبوة 3 0
صبغة جمسا 500مل لصبغ شرائح مسحات الدم 33 مستلزمات تشخيصية Giemsa stain, 500 ml. Ready to use solution intended for staining blood smears and blood samples طقم 4 0
صبغة ليشمان عبوة 1 لتر 29 مستلزمات تشخيصية Leishman stain solution: Combination of methylene blue azure as the basic dye component and eosin as the acidic dye component. is used in microscopy for staining blood smears. It is generally used to differentiate and identify leucocytes, malaria parasites, and trypanosomas. It is based on a methanolic mixture of "polychromed" methylene blue and eosin. عبوة 5 0
طقم صبغة الميثيلين الأزرق متعدد الألوان للكشف عن بكتيريا الحمى الفحمية الصبغة 250 مل زائد المحلول المثبت 250 مل 19 مستلزمات تشخيصية Polychrome methylene blue stain: staining procedure for blood or tissue smears found from dead animals (M'Fadyean's reaction) a highly reliable, rapid diagnostic test for anthrax. Composed of polychrome MB (250 ml) and ploychrome MB fixitive (250 ml) طقم 6 0
محلول لاكتوفينول لصبغ الفطريات عبوة100 مل 5 مستلزمات تشخيصية Lactophenol solution For staining of molds. 100 ml bottle عبوة 7 0

7 بند

جدول 29 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بروتين التريبانوسوما لتشخيص السرة 10 مستلزمات تشخيصية Trypanosoma Evansi (Surra) Antigen (RoTat 1.2VSG) عبوة 1 0
مصل مضاد للغلوبولين المناعي للخيول مربوط مع الانزيم 10 مستلزمات تشخيصية (Anti-Horse IgG (whole molecule)−Peroxidase antibody produced in rabbit (Sigma A6917-1ML). عبوة 2 0
اطباق اليزا لاصق للبروتين ماكسيسورب 10 مستلزمات تشخيصية Nunc-Immuno MicroWell 96 well solid plates M9410-1CS Pack of 60 plates صندوق 3 0
صواني شمعية للحام للانابيب الشعرية 23 مستلزمات تشخيصية Wax trays for capillary tube sealing Non-toxic, non-drying and non-hardening, the sealant is formulated to withstand centrifugation وحدة 4 0
كبريتات الزنك للاستخدام المخبري عبوة 500جم 17 مستلزمات تشخيصية zinc sulphate powder for laboratory use (pack/500g) عبوة 5 0
انابيب هيماتوكريت صغيره شعرية 100انبوبة الصندوق 95 مستلزمات تشخيصية Heparinized Capillary Tubes; I.D.: 1.1 - 1.2MM; Wall Thickness: 0.2mm (+/- .2mm); Length: 75mm (100tubes/box) صندوق 6 0
شريحة ماكماستر لعد بيض الديدان 19 مستلزمات تشخيصية McMaster Method Microscope Slide used for performing faecal worm egg counts (F.E.Cs). Faecal worm egg counts are performed on faeces samples mainly from large animals such as horses, sheep and cattle which normally harbour low levels of worms in their guts. وحدة 7 0
أقماع بيرمان للكشف عن النيماتودا 24 مستلزمات تشخيصية أقماع بيرمان Baerman funnels Funnel stand- Rubber or plastic tubing- Clamp or spring clip- Cheesecloth or dental napkin- Thin stick or metal rod- Strainer. حبة 8 0
قنينة تعويم للكشف المخبري عن الطفيليات 952 مستلزمات تشخيصية قنينة تعويم Floatation vials Vials for floatation technique for parasitic eggs and cysts حبة 9 0
جارات بلاستيكية معملية 48 مستلزمات تشخيصية جارات بلاستيكية معملية Plastic jars Large, high density polyethylene utility jar · Hundreds of uses around the lab · Wide mouth, natural color · Withstands temperatures of 110ºC حبة 10 0
أداة طحن العينة من البورسالين بحجم 500 مل 29 مستلزمات تشخيصية Mortar and pestle Porcelain Pestle & Mortar- 500 mL- Overall Dimensions: not less than 125 mm I.D. حبة 11 0
أغطية شرائح زجاجية علبة 100 حبة 343 مستلزمات تشخيصية Slide coverslips non-Sterile- ABOUT L*W  12 mm × 12 mm- Made of finest optical borosilicate glass, with uniform thickness and size- Corrosion-resistant (100/pack) علبة 12 0
شرائح ميكروسكوب زجاجية بجانب ابيض للترقيم صندوق 50 حبة 952 مستلزمات تشخيصية Microscopic glass slides with silky frosted marking area Corrosion-resistant, The edges are ground smooth to help eliminate sharp cutting surfaces and safe handling. They are packed in a special thermoform plastic box to minimize exposure to moisture and dust- size: 25 mm × 75 mm- have rough area to write on. 50pcs/box صندوق 13 0
ميثانول للاستخدام المخبري العام 34 مستلزمات تشخيصية methanol: ≥95% for general laboratory use. (2.5 l/bottle) عبوة 14 0
طبق بتري كبير لأغراض الكشف عن عينات الروث بمقاس 150mm في 20mm 2381 مستلزمات تشخيصية petri-dishes 150X20 mm for fecal samples طبق 15 0

15 بند

جدول 30 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
شفرات مشرط معقمة مقاس 4 صندوق25 حبة 48 مستلزمات تشخيصية sterile Scalpel  blades (No. 4) Stainless Steel- Individual Foil Packs of 25 blades: Blades that fit the No 4 Handles حبة 1 0
حامل شفرات مشرط مقاس 4 48 مستلزمات تشخيصية حامل شفرات مشرط (مقاس 4) Scalpel blades   holder (No. 4) No 4 Stainless Steel Graduated Handle. Overall Length 130mm. The Handles individually wrapped. حبة 2 0
كلوروفورم عبوة1 لتر 19 مستلزمات تشخيصية Chloroform anhydrous, ≥99%, 0.5-1.0% ethanol as stabilizer and preserved in PVC-coated bottle عبوة 3 0
أكياس معقمة لجمع العينات صغير 4762 مستلزمات تشخيصية أكياس معقمة لجمع العينات (صغير) Sample collecting bags (small) Made of highly resistant FDA approved virgin polyethylene sterile tubing with no side seals. A wire closure for an airtight seal. كيس 4 0
أكياس معقمة لجمع العينات كبير 4762 مستلزمات تشخيصية أكياس معقمة لجمع العينات (كبير) Sample collecting bags (large) Made with highly resistant FDA approved virgin polyethylene sterile tubing with no side seals. a wire closure for an airtight seal كيس 5 0
جار كوبلين زجاجي لصبغ الشرائح بحجم 60 مل 48 مستلزمات تشخيصية جار كوبلين Coplin jars Diameter (Metric)- 40mm- Slide Count: 10 - Coplin, Glass حبة 6 0
فورمالين 37 عبوة لتر 57 مستلزمات تشخيصية Formaldehyde solution:  37 wt. % in H2O, contains 10-15% Methanol as stabilizer, 1.0L/bottle عبوة 7 0
خزانة حفظ الشرائح 400 شريحة 11 مستلزمات تشخيصية Slide cabinet for preservation of microscopic slides: Each cabinet unit contains4 dual slotted drawers (capacity 100 slide/drawer) عبوة 8 0
زايلين عبوة 4 لتر 29 مستلزمات تشخيصية xylene:liqiud form, density 0.86 g/mL at 25 °C (4 lit.) عبوة 9 0
شمع برافين نقي كيس 1كيلو جرام 95 مستلزمات تشخيصية paraffin wax : Paraplast High Melt embedding media made from a combination of highly purified wax and plastic polymers of regulated molecular weights (1 kg/pack). كيس 10 0
طقم صبغة هيماتوكسيلين وايوسين 250 ملليلتر لكل 14 مستلزمات تشخيصية H&E liquid stain kit: Harris Hematoxylin pint, Eosin Y Stain pint, Differentiating Solution pint, and Bluing Solution pint (250 ml each) طقم 11 0
مادة تغطية شرائح العبوة الزجاجية 500 مل 38 مستلزمات تشخيصية مادة تغطية شرائح (DPX petrix) حجم العبوة الزجاجية 500 مل عبوة 12 0
شرائح زجاجية لفحص الانسجة علبة 100حبة 381 مستلزمات تشخيصية Microscopic Slides: Slee Medical Iso Norm 8037/1 StarFrost 50 Pieces Ground 76×26 mm (3×1 inch) Weiss/white advanced adhesive علبة (100حبة) علبة 13 0
غطاء شرائح للانسجة علبة 100حبة 381 مستلزمات تشخيصية غطاء شرائح Cover Slips: Slee Medical StarFrost 24x60 mm AutomatStar علبة (100حبة) علبة 14 0
شفرات ميكروتوم منخفضة 57 مستلزمات تشخيصية شفرات ميكروتوم منخفضة    Low profile microtome blades 22/80 mm علبة (50شفرة) علبة 15 0

15 بند

جدول 31 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أنبوب ناقل فيروسي كرتونة 50 انبوبة 24 مستلزمات تشخيصية أنبوب ناقل فيروسي كرتونة 50 انبوبة Viral transport medium tube is used for the collection and transportation of various RNA & DNA viruses Ensure stable virus activity and inhibit bacterial growth. 10ml TUBE Contain 3ml medium. كرتونة 1 0
انابيب كرايو سعة 2 مل مع صندوق حفظ لمائة أنبوبة صندوق100حبة 1429 مستلزمات تشخيصية انابيب كرايو 2 مل Cryotubes) 2ml) Noncytotoxic raw materials for added sample security and tubes certified free of DNAse and RNase for genomic applications - Self-standing tubes for ease of use on the bench top. حبة 2 0
طقم أقلام كتابة على أنابيب كرايو مجموعة4 حبات 95 مستلزمات تشخيصية Cryo marker pens : For permanently marking of cryotube and lab plastics. Smudge-proof ink will not fade at ultra-low temperatures. Extra fine tip. (pack of 4 pens) طقم 3 0
مسحات قطنية معقمة عادية لجمع العينات 1429 مستلزمات تشخيصية مسحات قطنية معقمة لجمع العينات Sterile cotton Swabs Overall Length: 6" (152.4 mm): Handle: Wood -Tip Material: Cotton- Sterile- Individually wrapped cotton swabs- Tested to be DNA-free حبة 4 0
صندوق نقل عينات معدية ثلاثي التغليف 10 مستلزمات تشخيصية صندوق نقل عينات مُعدية ثلاثي التغليف: A triple-packaging infectious samples transport  box: Certified UN-type packaging box (triple packaging) for transportation of infectious substanceDesign and make are compliant with UN 2814 (infectious substance affecting humans, category A) and approved for Class 6.2 goods.Leak-proof box, with inserts providing barriers Primary packing – capacity: 4 (four) to 6 (six) vacuum tubes in size 5to 7mlSecondary packing: plastic container, 40x150mm (diam x h), fitted with absorbent material Tertiary packing: Very strong cardboard (sturdy enough to withstand being dropped from 3 meters high), with minimal dimensions (to reduce air-freight cost), includes integrated space for 0.3L cool-pack (for short-distance transportation) or dry-ice (for long-distance transportation)Labelling of tertiary packing in accordance with regulation for UN 2814 صندوق 5 0
مسحات قطنية معقمة لجمع العينات مفردة خالية من الحمض النووي عبوة100 حبة 17 مستلزمات تشخيصية مسحات قطنية معقمة لجمع العينات, مفردة, خالية من الحمض النووي (عبوة/100 حبة) Sterile cotton Swabs. Overall Length: 6" (152.4 mm): Handle: Wood -Tip Material: Cotton- Sterile- Individually wrapped cotton swabs- Tested to be DNA-free حبة 6 0
أكياس معقمة لجمع العينات المخبرية متوسط صندوق 50 حبة 29 مستلزمات تشخيصية أكياس معقمة لجمع العينات المخبرية (متوسط) (صندوق/ 50 حبة Sample collecting bags (medium). Made with highly resistant FDA approved virgin polyethylene sterile tubing with no side seals. a wire closure for an airtight sea صندوق 7 0
حاويات جمع عينات بلاستيكية معقمة غطاء حلزونى قابلة للتعقيم سعة 1905 مستلزمات تشخيصية حاويات جمع عينات بلاستيكية معقمة مخبرية, غطاء حلزونى, قابلة للتعقيم سعة (200 - 250 ملللتر) Specimen containers: Leak- proof, plastic autoclavable , 200-250 ml capacity. حبة 8 0
أقلام ترقيم مخبرية متعددة الاحجام طقم 5 حبة 57 مستلزمات تشخيصية Marker pens for a variety of laboratory applications: This includes a flame-resistant water-proof permanent marker for metal surfaces, such as iron and stainless steel, ethanol- and alcohol-resistant markers, different size tips (pack of 5) حبة 9 0
اوراق ترشيح حجم متوسط صندوق100 حبة 29 مستلزمات تشخيصية Filter paper (medium size) Retains medium to medium- fine particulates, slow flow rate, smooth, normal hardness- Absorption speed*2 (cm): 5.0- Thickness (mm):not more than 0.18. صندوق 10 0
كمامات ان 95 صندوق20 حبه 952 مستلزمات تشخيصية كمامات ان 95 N95 mask respirators Soft inner shell for greater comfort! Fluid Resistant! Niosh Approved Meets CDC guidelines 20 Per Box. حبة 11 0
قفازات طبية لاتكس احادية الاستعمال مقاس صغير 1429 مستلزمات تشخيصية قفازات طبية لاتكس احادية الاستعمال مقاس صغير Disposable latex gloves (small size) High anti tear properties- Beaded cuff for tear resistance- Ambidextrous, Powder Free Latex Gloves- Made of high quality natural rubber. With high quality. علبة 12 0
قفازات طبية لاتكس احادية الاستعمال مقاس كبير 1429 مستلزمات تشخيصية قفازات طبية لاتكس احادية الاستعمال مقاس كبير Disposable latex gloves (large size) High anti tear properties- Beaded cuff for tear resistance- Ambidextrous, Powder Free Latex Gloves- Made of high quality natural rubber. With high quality. علبة 13 0
قفازات طبية لاتكس احادية الاستعمال مقاس متوسط 1429 مستلزمات تشخيصية قفازات طبية لاتكس احادية الاستعمال مقاس متوسط Disposable latex gloves (medium size) High anti tear properties- Beaded cuff for tear resistance- Ambidextrous, Powder Free Latex Gloves- Made of high quality natural rubber. With high quality. علبة 14 0
قفازات طبية لاتكس احادية الاستعمال مقاس كبير جدا 1429 مستلزمات تشخيصية قفازات طبية لاتكس احادية الاستعمال مقاس كبير جدا Disposable latex gloves ( x - large size) High anti tear properties- Beaded cuff for tear resistance- Ambidextrous, Powder Free Latex Gloves- Made of high quality natural rubber. With high quality. علبة 15 0

15 بند

جدول 32 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انابيب طرد مركزي معقمة 15مل انابيب فالكون 952 مستلزمات تشخيصية high speed sterile centrifuge tube  (15ml) polycarbonate round-bottom centrifuge tubes screw-capped حبة 1 0
انابيب طرد مركزي معقمة 50 مل انابيب فالكون 714 مستلزمات تشخيصية high speed sterile centrifuge tube  (50ml) polycarbonate round-bottom centrifuge tubes screw-capped حبة 2 0
انابيب ابندورف 2 مل كيس 500 حبة 95 مستلزمات تشخيصية انابيب ابندورف (2 مل) Eppendorf tubes(2ml( Polypropylene graduated microcentrifuge tube-with a flat cap. Certified RNase, DNase, and DNA free. Tested pyrogen free. Frosted side-writing surface. Easy opening cap has a beveled lip for comfort in repeated openings. كيس 3 0
انابيب ابندورف 1 5 مل كيس 500 حبة 95 مستلزمات تشخيصية انابيب ابندورف (1.5 مل) Eppendorf tubes(1.5ml( Polypropylene graduated microcentrifuge tube-with a flat cap. Certified RNase, DNase, and DNA free. Tested pyrogen free. Frosted side-writing surface. Easy opening cap has a beveled lip for comfort in repeated openings. ( 500 حبة) كيس 4 0
انابيب بي سي أر 0 2 مل كيس 500 حبة 95 مستلزمات تشخيصية PCR tubes (0.2ml (polypropylene graduated microcentrifuge tube-with a flat cap. Certified RNase, DNase, and DNA free. Tested pyrogen free. Frosted side-writing surface. Easy opening cap has a beveled lip for comfort in repeated openings. حبة 5 0
حامل انابيب اختبار قابل للتعقيم سعة 20 أنبوب 143 مستلزمات تشخيصية حامل انابيب اختبار سعة 20 أنبوب tube rack 20 20 mm diameter – for 20 tubes حبة 6 0
حامل أنابيب ابندورف سعة 36 انبوبة بحجم 1 5 2مل قابل للتعقيم 238 مستلزمات تشخيصية حامل أنابيب سعة 2مل tube rack (tube 2ml) حبة 7 0
أطباق بتري معقمة أحادية الاستعمال من البوليستيرين بحجم 90x 15 mm 14286 مستلزمات تشخيصية أطباق بتري Sterile Petri dishes 90x 15 mm polystyrene stackable petri dish طبق 8 0
مرشح سرنجات معقم استخدام مرة واحدة 022 ميكرون صندوق 50 حبة 952 مستلزمات تشخيصية فلتر سرنجات 0.22 ميكرون Filter syringe 0.22 micron 30mm diameter حبة 9 0
مرشح سرنجات معقم استخدام مرة واحدة 045 ميكرون صندوق 50 حبة 952 مستلزمات تشخيصية مرشح للسرنجة استخدام مرة واحدة مقاسات 0.45 ميكرو Single-use syringe filter sizes 0.45 μm حبة 10 0
حوض تخفيف لمحاليل الاليزا وحدة200 حبة 190 مستلزمات تشخيصية ELISA Reagent Reservoir Sterile disposable polystyrene reservoir, 50 ml capacity, graduated (unit/200 piece) وحدة 11 0
بنسلين مائي Penecillin G 11 مستلزمات تشخيصية Penecillin: water soluble, for I/M and I/V injection, 2000000/vial عبوة 12 0
بوكسات حفظ الأبندورف 1 5 مل 190 مستلزمات تشخيصية Rack (box) for Ependorf 1.5 ml بوكسات حفظ الأبندورف 1,5 مل صندوق 13 0
انابيب حبيبات خضراء لجهاز ماجنا لايزر 100عبوة 24 مستلزمات تشخيصية Magna lyser green beadsMagNA Lyser Green Beads are supplied in 2-ml screw-capped tubes, prefilled with 1.4-mm (diameter) ceramic beads (100tube /pack) صندوق 14 0
لوح زجاجي لاختبار الروزبنغال 143 مستلزمات تشخيصية لوح زجاجي لاختبار الروزبنغال Glass plates for rose Bengal test. 24 cavities – staining plates with ground- in and polished cavities of approx.3 mm depth – float glass – beveled edges , clipped – off corners. حبة 15 0
أنابيب زجاجية بغطاء حلزوني قابلة للتعقيم 71 مستلزمات تشخيصية أنابيب زجاجية بغطاء حلزوني قابلة للتعقيم Glass test tubes screw capped, autoclavable , 9 mm, (144/ box) عبوة 16 0

16 بند

جدول 33 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي الرمز الإنشائي منتج من القائمة الإلزامية
أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية مقاس L واقي ضد الاخطار البيولوجية سحاب ثنائي مع غطاء مغلف بشريط لاصق مصنوع من مواد مرنة 286 مستلزمات تشخيصية أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية (مقاس L): واقي ضد الاخطار البيولوجية، سحاب ثنائي مع غطاء مغلف بشريط لاصق، مصنوع من مواد مرنة. Safety coverall made of polyethelene + polyster/polyethylenelaminate (size: L) حبة 1 1005 1
أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية مقاس S واقي ضد الاخطار البيولوجية سحاب ثنائي مع غطاء مغلف بشريط لاصق مصنوع من مواد مرنة 286 مستلزمات تشخيصية أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية (مقاس S): واقي ضد الاخطار البيولوجية، سحاب ثنائي مع غطاء مغلف بشريط لاصق، مصنوع من مواد مرنة. Safety coverall made of polyethelene + polyster/polyethylenelaminate (size: S) حبة 2 1005 1
أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية مقاس Mواقي ضد الاخطار البيولوجية سحاب ثنائي مع غطاء مغلف بشريط لاصق مصنوع من مواد مرنة 286 مستلزمات تشخيصية أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية (مقاس M): واقي ضد الاخطار البيولوجية، سحاب ثنائي مع غطاء مغلف بشريط لاصق، مصنوع من مواد مرنة. Safety coverall made of polyethelene + polyster/polyethylenelaminate (size: M) حبة 3 1005 1
أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية مقاس XL واقي ضد الاخطار البيولوجية سحاب ثنائي مع غطاء مغلف بشريط لاصق مصنوع من مواد مرنة 286 مستلزمات تشخيصية أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية (مقاس XL): واقي ضد الاخطار البيولوجية، سحاب ثنائي مع غطاء مغلف بشريط لاصق، مصنوع من مواد مرنة. Safety coverall made of polyethelene + polyster/polyethylenelaminate (size: XL) حبة 4 1005 1
أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية مقاس XXLواقي ضد الاخطار البيولوجية سحاب ثنائي مع غطاء مغلف بشريط لاصق مصنوع من مواد مرنة 286 مستلزمات تشخيصية أفرول لكامل الجسم بكم طويل أحادي الاستعمال ذو جودة عالية (مقاس XXL): واقي ضد الاخطار البيولوجية، سحاب ثنائي مع غطاء مغلف بشريط لاصق، مصنوع من مواد مرنة. Safety coverall made of polyethelene + polyster/polyethylenelaminate (size: XXL) حبة 5 1005 1
بالطو مختبر ابيض مقاس 40 57 مستلزمات تشخيصية بالطو مختبر ابيض مقاس 40 White lab coat size 40 Full-length lab coat with chest pocket and lapel collar features 5 cloth knot buttons, front pockets, and side seam slits for easy pants pocket access. 44" length. 100% Cotton. Size 40 coincide with chest measurements. حبة 6 2503 1
بالطو مختبر ابيض مقاس 52 57 مستلزمات تشخيصية بالطو مختبر ابيض مقاس 52 White lab coat size 52 Full-length lab coat with chest pocket and lapel collar features 5 cloth knot buttons, front pockets, and side seam slits for easy pants pocket access. 44" length. 100% Cotton. Size 52 coincide with chest measurements. حبة 7 2503 1
أغطية راس مخبرية زرقاء أحادية الاستعمال 100حبةصندوق 574 مستلزمات تشخيصية overhead أغطية راس كرتون 8 1218 1
اغطية أحذية أحادية الاستعمال للمختبرات  100حبةحزمة 952 مستلزمات تشخيصية overshoes اغطية أحذية كرتون 9 1217 1
كمامات مختبر أحادية الاستعمال كرتون50 حبة 571 مستلزمات تشخيصية كمامات مختبر أحادية الاستعمال Laboratory mask Laboratory disposable masks Pleat style with ear loops. Enclosed nosepiece to assist in conforming to the contours of the face Protective three-layer construction Materials and donning attachments are sonically bonded Mask is natural rubber latex-free كرتون 10 0
نظارات مختبر واقية 95 مستلزمات تشخيصية نظارات مختبر واقية Eye protection glasses Lens Coating: Antifog, Frame Design: Wraparound -Frame Material: Polycarbonate-Lens., UV Protection: 99.9%. With a modern slim design- soft pliable frame – modern slim – line and lightweight design for an excellent fit. حبة 11 2528 1
مطهر للايدي عالي الفعالية يجف سريعا ويمكن استعماله عدة مرات بدون تأثير ضار 1000مل عبوة 476 مستلزمات مخبرية Hand antiseptic (1000 ml): Broad-spectrum activity kills 99.999% of harmful bacteria, Dries quickly without leaving hands sticky, contains 70% ethanol. عبوة 12 1000 1
ايثانول عالي النقاوة عبوة زجاجية 5 2 لتر 95 مستلزمات تشخيصية Absolute Ethyl alcohol extra pure (bottle/2.5 litre) عبوة 13 0
اسيتون نقي 98 عبوة 1 لتر 29 مستلزمات تشخيصية Acetone pure 98% (1 litre/bottle). عبوة 14 0
قفاز يد للحماية من البرودة والنتروجين السائل 67 مستلزمات تشخيصية قفاز يد للحماية من البرودة والنتروجين السائل (حجم كبير) Hand gloves: For protection against cold temperature and liquid nitrogen vapour (large size حبة 15 0
حافظات محمولة لحفظ العينات مع أوعية ثلج 38 مستلزمات تشخيصية حافظات محمولة لحفظ العينات مع أوعية ثلج (10 لتر) Portable containers for sample transport with 10 suitable ice pads: For preservation of clinical samples during transportation (6-10 L capacity) made from PP material, non toxic, temperature range 2-8°C, storage time > 48 hour حبة 16 0

16 بند

جدول 34 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
اكياس جهاز التعقيم حجم كبير 4762 مستلزمات تشخيصية اكياس جهاز التعقيم حجم كبير Laboratory autoclave bags large  size BIOHAZARD AUTOCLAVE BAGS size 61×91.4cm × volume 100L . Resists punctures, tears and leaks كيس 1 0
اكياس جهاز التعقيم حجم وسط 4762 مستلزمات تشخيصية اكياس جهاز التعقيم حجم وسط Laboratory autoclave bags medium  size BIOHAZARD AUTOCLAVE BAGS size 61×76.2cm × volume 78L. Resists punctures, tears and leaks كيس 2 0
أكياس جهاز التعقيم حجم صغير 4762 مستلزمات تشخيصية أكياس جهاز التعقيم حجم صغير Laboratory autoclave bags small  size BIOHAZARD AUTOCLAVE BAGS size 30.5×61cm × volume 16L. Resists punctures, tears and leaks. كيس 3 0
اكياس نفايات مختبر حجم كبير 9524 مستلزمات تشخيصية اكياس نفايات مختبر حجم كبير Laboratory waste bags large  size BIOHAZARD disposal bags 90×120cm×22micron. - Resists punctures, tears and leaks كيس 4 0
اكياس نفايات مختبر حجم وسط 9524 مستلزمات تشخيصية اكياس نفايات مختبر حجم وسط Laboratory waste bags medium  size BIOHAZARD disposal bags 76×100cm×22micron.  Resists punctures, tears and leaks كيس 5 0
أكياس نفايات مختبر حجم صغير 9524 مستلزمات تشخيصية أكياس نفايات مختبر حجم صغير Laboratory waste bags small  size BIOHAZARD disposal bags 45×54cm×8micron. - Resists punctures, tears and leaks. كيس 6 0
صناديق النفايات الطبية 29 مستلزمات تشخيصية صناديق النفايات الطبية biohazard waste containers -Polyethylene construction -Meets OSHA requirements for exposures to blood-borne pathogens -Foot lever reduces user’s hands-on exposure 30 gallon صندوق 7 0
صناديق النفايات الحادة الطبية 29 مستلزمات تشخيصية صناديق النفايات الحادة الطبية - sharps container -Polyethylene construction -Meets OSHA requirements for exposures to blood-borne pathogens -Foot lever reduces user’s hands-on exposure 17.5 litre صندوق 8 0
ورق تنظيف عدسات المجهر وحدة100 حبة 95 مستلزمات تشخيصية ورق تنظيف عدسات المجهر Microscope lens cleaning tissue 100 Sheets of high quality optics cleaning tissue Safe on all optical surfaces; including microscopes, camera optics, reading glasses, sunglasses and more. وحدة 9 0
ورق تنظيف مختبر كرتون200 حبة 952 مستلزمات تشخيصية ورق تنظيف مختبر Laboratory towel paper C-Fold Paper Towels 10-1/8" x 13-3/20" White 200/Pack 12/Carton, White كرتون 10 0
رول بارافيلم للاستخدام المخبري عرض 4 بوصات وطول 125 قدم 190 مستلزمات تشخيصية parafilm roll 4 inch x 125ft, This semitransparent thermo-plastic is moisture proof, flexible and resistant to alcohol, gases and most acids. For sealing of vessels حبه 11 0

11 بند

جدول 35 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
نورمال سالين 500 مل 286 مستلزمات تشخيصية Normal saline 500 ml نورمال سالين 500 مل عبوة 1 0
بودرة كلوريد الصوديوم 500 جم عبوة 48 مستلزمات تشخيصية Sodium chloride laboratory grade ( 500 g/pack) عبوة 2 0
أقراص الفوسفات المتعادلة عبوة 100حبة 71 مستلزمات تشخيصية Phosphate-buffered saline tabs (PBS) (100 tab/pack) عبوة 3 0
حمض الهيدروكلوريك عبوة1 لتر 8 مستلزمات تشخيصية حمض الهيدروكلوريك (عبوة/1 لتر) Hydrochloric acid concentrated 1 liter bottle عبوه 4 0
بودرة استات الثاليوم لزرع المايكوبلازما 25جم 3 مستلزمات تشخيصية Thalium acetate powder: - Used in the laboratories as a selective element against gram-negative bacteria in selective media for the detection of mollicutes. - Pack/25 gm. عبوة 5 0
بودرة هيدروكسيد الصوديوم 500جم عبوة 7 مستلزمات تشخيصية Sodium Hydroxide (NaOH) laboratory grade 500 G عبوة 6 0
بودرة جلوكوز للاستعمال المخبري عبوة500 جم 7 مستلزمات تشخيصية Glucose powder (laboratory grade) (500gm / pack) عبوة 7 0
بودرة بروتينيز كى عبوة 100ملج 17 مستلزمات تشخيصية Proteinase K powder. Contents: Proteinase K 100mg Specific Activity:40 U/mg protein Form:Contains 100 mg Proteinase K, Lyophilized Powder. عبوة 8 0
محلول ألسفير 1 لتر 48 مستلزمات تشخيصية Alsevers solution 1L. An isotonic, balanced salt sterile solution. This product is composed of (in g/L): NaCl (4.2)/ Citric Acid•3Na•2H2O (8.0) Citric Acid•H2O (0.55) / D-Glucose (20.5). عبوة 9 0
ايزوبروبانول تركيز 995 عبوة1 لتر 10 مستلزمات تشخيصية Isopropanol ≥99.5%, ACS reagent, suitable for RNA extraction (1 litre / bottle) عبوة 10 0
ترايزول عبوة100 مل 6 مستلزمات تشخيصية Trizol reagent (100ml): For the isolation of high quality RNA, DNA and protein from a variety of biological samples عبوة 11 0
سائل توين 20 40 عبوة 250 مل 10 مستلزمات تشخيصية Tween 20 (≥40.0% (GC) 250 mll bottle: composed of lauric acid, ≥40% (balance primarily myristic, palmitic, and stearic acids) عبوة 12 0
هيدروجين بيروكسيد 100 مل 34 مستلزمات تشخيصية H2O2 concentrated 100ML عبوة 13 0
1 litre bottle حامض النيتريك 6 مستلزمات تشخيصية Nitric acid concentration ≥65-70% in nitric acid (high purity) (1 litre / bottle) حبة 14 0

14 بند

جدول 36 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
جل صبغة الحامض النووي سايبر 04 مل عبوة 48 مستلزمات تشخيصية SYBR Safe DNA Gel Stain  -highly sensitive stain for visualization of DNA in agarose or acrylamide gels عبوة 1 0
صبغة تحميل الحمض النووي عبوة5 مل 48 مستلزمات تشخيصية BLUE/ORANGE/ LOADING DYE FOR GEL ELECTROPHORESIS Blue/Orange Loading Dye, 6X, is a convenient marker dye containing 0.4% orange G, 0.03% bromophenol blue, 0.03% xylene cyanol FF, 15% Ficoll® 400, 10mM Tris-HCl (pH 7.5) and 50mM EDTA (pH 8.0). Ready-to-use form. عبوة 2 0
معلم دي ان ايه من 100 الى 1000 قاعدة مزدوجة 48 مستلزمات تشخيصية bp DNA Ladder, ready-to-use. ready-to-load DNA Ladder is premixed with 6X TriTrack DNA Loading dye. Size Range: 100 bp to 1000 bp (10 DNA fragments) Content:100 bp DNA Ladder, ready-to-use (50 µg (for 100 applications), 0.1 µg/µL)+ 6X TriTrack DNA Loading Dye (1 mL). وحدة 3 0
معلم دي ان ايه من 250 الى 15000 قاعدة مزدوجة 48 مستلزمات تشخيصية High Range Ladder is a ready-to-use DNA Marker suitable for sizing linear double-stranded DNA fragments from 250bp-15000bp, and composed of 7 linear chromatography-purified individual DNA fragments. طقم 4 0
اجاروز درجة البيولوجيا الجزيئية 48 مستلزمات تشخيصية Pure™ Agarose Separation Range: 100 bp to >30 kb of DNA and RNA fragments. Has no detectable DNase or RNase activity Quantity: 1 pouch containing 500 g of UltraPure Agarose . 500 g. عبوة 5 0
محلول تي بي آي 1لتر X10 48 مستلزمات تشخيصية X10 TBE (Tris-borate-EDTA). A ready to mix buffer reagent used for DNA and RNA polyacrylamide gel electrophoresis. Makes 1 L of 10X. عبوة 6 0
محلول تي أيه إي TAE 1 لتر X10 48 مستلزمات تشخيصية TAE Buffer, 10X Pure™ 10X TAE Buffer is a sterile-filtered solution of 400 mM Tris-acetate and 10 mM EDTA. 1 L plastic bottles عبوة 7 0
معلم دي ان ايه من 100 الى 6000 33 مستلزمات تشخيصية معلم دي ان ايه من 100 الى 6000 قاعدة مزدوجة - 100 bp DNA Ladder, ready-to-use. ready-to-load DNA Ladder is premixed with 6X TriTrack DNA Loading dye. Size Range: 100 bp to 3000 bp (14 DNA fragments) Content:100 bp DNA Ladder, ready-to-use (50 µg (for 100 applications), 0.1 µg/µL)+ 6X TriTrack DNA Loading Dye (1 mL). طقم 8 0
انابيب لايت سايكلر صندوق 96 حبة 95 مستلزمات تشخيصية LightCycler Capillaries (20 μl) A glass capillary is molded to a polypropylene reservoir, Stopper provides a secure seal, significantly - High-quality borosilicate glass ensures superior PCR performance and optimal fluorescence transmission reducing the risk of contamination. The capillary can hold reaction volumes ranging from 10 to 20 μl. صندوق 9 0
أطباق لايت سايكلر 9650 حبة صندوق 24 مستلزمات تشخيصية LightCycler 480 Multiwell Plate 96, white: High-performance reaction device tailor-made for the LightCycler® 96 Instrument and the LightCycler® 480 and LightCycler® PRO Instruments, 96-well version. صندوق 10 0
ماء ثنائي التقطير منزوع الايونات معقم خالى من الأحماض النووية وانزيمات تكسيرها لاختبار PCR صندوق25 مل 23 مستلزمات تشخيصية RNA/DNA free water box for molecular biology techniques (box/25ml in aliqouts) حبه 11 0
مصل الخيل المعقم لزرع المايكوبلازما 100مل 14 مستلزمات تشخيصية Horse serum for the cultivation of mycoplasma: 100 ml/bottle. Sterile/filtered. Shipping frozen in dry ice. EIA tested عبوة 12 0
اطباق 96 لجهاز تحديد التسلسل الجيني 20 طبق صندوق 10 مستلزمات تشخيصية MicroAmp Optical 96-Well Reaction Plate, (PCR compatible DNA/RNA/RNase free, Product size: 20 صندوق 13 0
انابيب مختبر بغطاء كرتون 1000 حبة 5 مستلزمات تشخيصية Tubes, 0.2 mL, domed cap (PCR Tube) Product size: 1,000 tubes كرتون 14 0
انابيب مختبر منخفضة مع الغطاء كرتون250 شريط 5 مستلزمات تشخيصية Low Profile Tubes and Domed Caps, strips of 8 Product size: 250 strips. كرتون 15 0

15 بند

جدول 37 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أنابيب كيوبيت 500حبة وحدة 10 مستلزمات تشخيصية Qubit Assay Tube Qubit assay tubes are 500 µL thin-walled polypropylene tubes for use with the Qubit Fluorometer. 500 tubes per package. Catalog number: Q32856 وحدة 1 0
ترايزول عبوة100 مل 6 مستلزمات تشخيصية Trizol reagent (100ml): For the isolation of high quality RNA, DNA and protein from a variety of biological samples عبوة 2 0
محلول تراس درجة البيولوجيا الجزيئية سائل pH 7 19 مستلزمات تشخيصية Tris-HCl, pH 7 : UltraPure™ 1 M Tris-HCl Buffer, pH 7.0, is a premixed, pH-adjusted, sterile-filtered solution. Prepared as a 1 M concentrate, this buffer can be diluted to the desired concentration and used in molecular biology (bottle/1 litre) عبوة 3 0
محلول تراس درجة البيولوجيا الجزيئية سائل pH 8 5 19 مستلزمات تشخيصية Tris-HCl, pH 8.5: UltraPure™ 1 M Tris-HCl Buffers are pre-mixed, pH-adjusted, sterile-filtered solutions. Prepared as 1 M concentrates, these buffers can be diluted to the desired concentration and used in molecular biology (bottle/1 litre) عبوة 4 0
انزيم ليغيز T4 2 مشخص T4 RNA Ligase 2 (dsRNA). T4 RNA Ligase 2 ligates nicks in dsRNA and can also be used to ligate the 3´ OH of RNA to the 5´ phosphate of DNA in a double stranded structure. • Suitable for ligating 3' OH of RNA to 5' phosphate of DNA in a DNA/RNA hybrid • Isolated from a recombinant source • Supplied with 10X Reaction Buffer عبوة 5 0
طقم جين رولر لقياس حجم الدي إن أي جاهز للاستخدام 5 مشخص GeneRuler 100bp DNA ladder, ready for use GeneRuler 100 bp DNA Ladder is recommended for sizing and approximate quantification of a double-stranded DNA in the range of 100 bp to 1,000 bp on agarose or polyacrylamide gels. The DNA ladder consists of 10 DNA fragments and is provided with 6X TriTrack DNA Loading Dye. طقم 6 0
طقم استخلاص الدنا من الجل 1 مشخص QIAquick Gel Extraction Kit QIAquick Gel Extraction Kit (1000) For gel extraction or cleanup of 1000 reactions: 1000 QIAquick Spin Columns, Buffers, Collection Tubes (2 ml) طقم 7 0
طقم التخلص من المادة الوراثية 2 مشخص DNA- free DNases kit (life technologies) (gDNA DEPLETION) (gDNA) طقم 8 0
طقم نكستيرا لتحضير الحمض النووي DNA 6 مشخص Nextera XT DNA Library Prep. Kit -(Box1, Box2) (24 samples) طقم 9 0
طقم تحليل تتابع التسلسل الوراثي للترقيم 5 مشخص Nextera XT Index Kit (24 Indexes, 96 Samples) Index Primers: S502, S504, S517, N701 and N706. طقم 10 0
طقم كاشف مايسيك v2 6 مشخص MiSeq Reagent Kit v2 - 500-Cycle (Box1, Box2) MiSeq sequencing reagents in pre-filled, ready-to-use. • Maximum Output: 7.5 -8.5 Gb. • Maximum Reads per Run: Up to 15 million. • Size (cycles): 500. • Nucleic Acid Type: DNA –RNA طقم 11 0
طقم ضابط فيكس FC 5 مشخص PHIX CONTROL KIT (v3) PhiX Control is a ready-to-use control library for sequencing runs. طقم 12 0
طقم تنقية الحامض النووي 5 مشخص Ampure XP Magntic purification kit – 5ml. Used for PCR Purification, NGS Clean-up, PCR clean-up. Liquid. طقم 13 0
طقم تحليل الحمض النووي دي ان ايه عالي الحساسية 11 مشخص Agilent High Sensitivity DNA Kit • Agilent High Sensitivity DNA Chips - 10 High Sensitivity DNA Chips - 1 Electrode Cleaner - Syringe Kit - 1 Syringe • Agilent High Sensitivity DNA Reagents (reorder-no 5067-4627) - yellow) High Sensitivity DNA Ladder - (green) High Sensitivity DNA Markers 35/10380 bp (4 vials) - (blue) High Sensitivity DNA Dye Concentrate 1 (1 vial) - red) High Sensitivity DNA Gel Matrix (2 vials) - 2 Spin Filters طقم 14 0

14 بند

جدول 38 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم الاكيوبت 5 مشخص Qubit dsDNA HS Assay Kit طقم 1 0
انزيم تضخم المادة الوراثية 11 مشخص SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (100 reactions). • 50uL SuperScript III RT/Platinum Tag Mix. • 1 mL 2X Reaction Mix (containing 0.4 mM of each dNTP, 3.2 mM MgSO4). 500 uL mM Magnesium Sulfate طقم 2 0
طقم تصنيع الخيط الثاني للحمض النووي 1 مشخص Double-Stranded cDNA Synthesis Kit (10 reaction) طقم 3 0
طقم تصنيع الحمض النووي دي ان إي High Fidelity 5 مشخص Platinum Taq DNA Polymerase High Fidelity 1 x 20 µL Platinum Taq DNA Polymerase High Fidelity (5 U/µL) • 1 x 1.25 mL 10X High Fidelity Buffer [600 mM Tris-SO4 (pH 8.9), 180 mM (NH4)2SO4] • 1 x 1 mL 50 mM MgSO4 Store at -10°C to -30°C. The number of 100 tests. طقم 4 0
مجموعات بوادئ للتتابع النيكليوتيدي الفيروسي لجهاز السكونسر 7 مشخص Primers for viral sequencing: - Package: 25 nmol / primer unit. - 4 primers/group. - HPLC quality مجموعة 5 0
مجموعة بادئات لتحديد تسلسل قواعد الحمض النووي لفيروس الحمى القلاعية باختبار RT PCR 2 مشخص PRIMERS FOR RT-QPCR AND COMPLEMENTARY FIRST STRAND SYNTHESIS. 3 PRIMER /GROUP مجموعة 6 0
مجموعة زوج بادئات للتعرف على فيروس جدري الإبل 2 مشخص Sets of primers for camel pox virus, 4 primer pairs/group مجموعة 7 0
مجموعة زوج بادئات للتعرف على فيروس جدري الماعز 2 مشخص Sets of primers for capripox virus, 7 primer pairs/group مجموعة 8 0
مجموعة بادئات لتضخيم قطع الجينات لفيروس اللسان الأزرق 10نانو مول عبوة 2 مشخص Sets of primers for BT virus. 2 primer pairs/group مجموعة 9 0
مجموعة زوج بادئات للتعرف على الحمى القلاعية 10نانو مول عبوة 2 مشخص Sets of primers for FMD virus. 23 primer/group مجموعة 10 0
مجموعة زوج بادئات للتعرف على طاعون المجترات 10نانو مول عبوة 2 مشخص Set of primers for PPR virus. Partial genome sequencing of PPR. 8 primer pairs/group مجموعة 11 0
زوج بادئات لاكثار الحمض النووي لفيروس canine distember 1 مشخص زوج بادئات لاكثار الحمض النووي لفيروس canine distember: F MAWTTTGGAGAGTCGGGGGAT, R GAACGCTGAGGAGACTGCCAA زوج بادئات 12 0
feline herpesvirus بادئات لاكثار الحامض النووي لفيروس هربس القطط 1 مشخص F AACTGCCCTCCATTCTACT, R TTGGTCCAGACTCCAACCTAT :feline herpesvirus بادئات لاكثار الحامض النووي لفيروس هربس القطط زوج بادئات 13 0
مجموعة زوج بادئات لتحديد تتابع فيروس الانفلونزا 10نانو مول عبوة 1 مشخص مجموعة زوج بادئات لتحديد تتابع فيروس الانفلونزا (10نانومول/عبوة): 5’-GCCGGAGCTCTGCAGATATCAGCRAAAGCAGG-3’ AIV-Uni 5’-GCCGGAGCTCTGCAGATATCAGCGAAAGCAGG-3’AIV-Uni 12G 5’-CAGGAAACAGCTATGACAGTAGAAACAAGG-3’ AIV-Uni 13 مجموعة 14 0
IBV 10nmoleمجموعة زوج بادئات 18 زوج للتعرف على فيروس التهاب الشعب الهوائية 1 مشخص A group pf primers for the identification of Infectious bronchitis virus (18 primer pairs/group) مجموعة 15 0
مجموعة بادئات لتحديد التتابع الجيني لفيروس الميرس مجموعة 98 بادئ 1 مشخص A group pf primers for the identification of MERS virus (98 primers /group) مجموعة 16 0

16 بند

جدول 39 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
كاشف بريمكس بي سي ار بوكيت المركزي للكشف انفلونزا الطيور النوع اتش 5 24 مشخص Influenza H5 Premix reagent Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. (24 اختبار/طقم) طقم 1 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف انفلونزا الطيور ااتش 9 36 مشخص Influenza H9 Premix reagent Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. (24 اختبار/طقم) طقم 2 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس حمى الوادي المتصدع 24 مشخص RVF Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 3 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس التهاب الجلد العقدي 36 مشخص LSD Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 4 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف انفلونزا الطيور النوع أ 71 مشخص Influenza A Premix reagent Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. (24 اختبار/طقم) طقم 5 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس اللسان الازرق 24 اختبار طقم 36 مشخص Blue tongue Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR. طقم 6 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس طاعون المجترات الصغيرة 36 مشخص PPR Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 7 0
كاشف بريمكس بي سي ار بوكيت المركزي للكشف عن فيروس ميرس كورونا اب أي جين 36 مشخص MERS-COV(upE) Premix Compatible with Pockit Central. 24 rxn/package, lyophilized, Contain primer+probe+master mix reagent in one vial IIPCR.(24 اختبار/طقم) طقم 8 0

8 بند

جدول 40 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أطقم انابيب منظمة الصحة العالمية كاملة لاختبار تشخيص مقاومة البعوض البالغ للمبيدات 5 مستلزمات تشخيصية Susceptibility test kit for monitoring insecticide resistance in adult mosquitoes (WHO/VBC/81.806) طقم 1 0
أطقم أنابيب منظمة الصحة العالمية كاملة لاختبار التقييم الحيوي لمقاومة البعوض البالغ للمبيدات المستخدمة على الأسطح 2 مستلزمات تشخيصية WHO test kits for adult mosquito bioassay on wall surfaces test kit (VBC/81.5), طقم 2 0
أطقم انابيب منظمة الصحة العالمية كاملة لاختبار تشخيص مقاومة يرقات البعوض للمبيدات 5 مستلزمات تشخيصية WHO test kits for monitoring insecticide resistance in mosquito larvae (WHO/VBC / 81.807), طقم 3 0
أطقم قوارير منظمة الصحة العالمية كاملة لاختبار تشخيص مقاومة يرقات البعوض لمثبطات النمو 2 مستلزمات تشخيصية WHO complete test kits for mosquitoes (Larvae resistance to development inhibitors) including one complete set of each insecticide and control- WHO/VBC/81.812, طقم 4 0
قوارير منظمة الصحة العالمية 250 ملليلتر لاختبارات التقييم الحيوي الطور البالغ للمبيدات 19 مستلزمات تشخيصية WHO CDC bottle bioassays (250 ml Wheaton bottles with screw caps) قارورة 5 0

5 بند

جدول 41 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أوراق مشبعة بمبيد قياسي مالاثيون 15 5 مستلزمات تشخيصية Malathion 1.5% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 1 0
أوراق مشبعة بمبيد قياسي مالاثيون 5 5 مستلزمات تشخيصية Malathoin 5% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 2 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 60mg m2 5 مستلزمات تشخيصية Pirimiphos-methyl 60mg-m2 Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 3 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 100mg m2 5 مستلزمات تشخيصية Pirimiphos-methyl 100mg-m2 Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 4 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 170mg m2 5 مستلزمات تشخيصية Pirimiphos-methyl 170mg-m2 Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 5 0
أوراق مشبعة بمبيد قياسي ألفا سايبرميثرين 005 5 مستلزمات تشخيصية Alpha-cypermethrin 0.05% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 6 0
أوراق مشبعة بمبيد قياسي ألفا سايبرميثرين 15 5 مستلزمات تشخيصية Alpha-cypermethrin 1.5% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 7 0
أوراق مشبعة بمبيد قياسي سايفلوثرين 5 مستلزمات تشخيصية Cyfluthrin 0.15% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 8 0
أوراق مشبعة بمبيد قياسي دلتاميثرين 0025 5 مستلزمات تشخيصية Deltamethrin 0.025% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 9 0
أوراق مشبعة بمبيد قياسي دلتاميثرين 003 5 مستلزمات تشخيصية Deltamethrin 0.03% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 10 0
أوراق مشبعة بمبيد قياسي إيتوفينبروكس 5 مستلزمات تشخيصية Etofenprox 0.5% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 11 0
أوراق مشبعة بمبيد قياسي لامدا سايهالوثرين 005 5 مستلزمات تشخيصية Lambda-cyhalothrin 0.05% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 12 0
أوراق مشبعة بمبيد قياسي لامدا سايهالوثرين 0025 5 مستلزمات تشخيصية Lambda-cyhalothrin 0.025% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 13 0
أوراق مشبعة بمبيد قياسي بيرميثرين 025 5 مستلزمات تشخيصية Permethrin 0.25% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 14 0
أوراق مشبعة بمبيد قياسي بيرميثرين 04 5 مستلزمات تشخيصية Permethrin 0.4% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 15 0

15 بند

جدول 42 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أوراق مشبعة بمبيد قياسي بيرميثرين 075 5 مستلزمات تشخيصية Permethrin 0.75% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 1 0
أوراق مشبعة بمبيد قياسي بريبنايل بيوتوكسيد 5 مستلزمات تشخيصية PBO 4.0% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 2 0
أوراق مشبعة بمبيد قياسي فينتروثين 5 مستلزمات تشخيصية Fenitrothion Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 3 0
أوراق مشبعة بمبيد قياسي كاربوسولفان 5 مستلزمات تشخيصية Carbosulfan 0.4% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 4 0
أوراق مشبعة بمبيد قياسي كلوربيريفوس إيثيل 5 مستلزمات تشخيصية Chlorpyrifos-ethyl 1% Insecticide impregnated papers (boxes) – each box contains 8 papers علبة 5 0
زيت الاوليف القياسي 5 مستلزمات تشخيصية Control in olive oil (OP/C control) علبة 6 0
زيت السيليكون القياسي 5 مستلزمات تشخيصية Control in silicone oil (PY and PBO control) علبة 7 0
أوراق مشبعة بمبيد قياسي مالاثيون 2 15 1 مستلزمات تشخيصية Malathion 1.5% (5X diagnostic concentrations) علبة 8 0
أوراق مشبعة بمبيد قياسي مالاثيون 2 5 1 مستلزمات تشخيصية Malathion 5% (5X diagnostic concentrations) علبة 9 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 2 60mgm2 1 مستلزمات تشخيصية Pirimiphos-methyl 60mg/m2 (5X diagnostic concentrations) علبة 10 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 2 100mgm2 1 مستلزمات تشخيصية Pirimiphos-methyl 100mg/m2 (5X diagnostic concentrations) علبة 11 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 2 170mgm2 1 مستلزمات تشخيصية Pirimiphos-methyl 170mg/m2 (5X diagnostic concentrations) علبة 12 0
أوراق مشبعة بمبيد قياسي ألفا سايبرميثرين 2 005 1 مستلزمات تشخيصية Alpha-cypermethrin 0.05% (5X diagnostic concentrations) علبة 13 0
أوراق مشبعة بمبيد قياسي ألفا سايبرميثرين 2 15 1 مستلزمات تشخيصية Alpha-cypermethrin 1.5% (5X diagnostic concentrations) علبة 14 0
أوراق مشبعة بمبيد قياسي سايفلوثرين 2 1 مستلزمات تشخيصية Cyfluthrin 0.15% (5X diagnostic concentrations) علبة 15 0

15 بند

جدول 43 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أوراق مشبعة بمبيد قياسي دلتاميثرين 2 0025 1 مستلزمات تشخيصية Deltamethrin 0.025% (5X diagnostic concentrations) علبة 1 0
أوراق مشبعة بمبيد قياسي دلتاميثرين 2 003 1 مستلزمات تشخيصية Deltamethrin 0.03% (5X diagnostic concentrations) علبة 2 0
أوراق مشبعة بمبيد قياسي إيتوفينبروكس 2 1 مستلزمات تشخيصية Etofenprox 0.5% (5X diagnostic concentrations) علبة 3 0
أوراق مشبعة بمبيد قياسي لامدا سايهالوثرين 2 005 1 مستلزمات تشخيصية Lambda-cyhalothrin 0.05% (5X diagnostic concentrations) علبة 4 0
أوراق مشبعة بمبيد قياسي لامدا سايهالوثرين 2 0025 1 مستلزمات تشخيصية Lambda-cyhalothrin 0.025% (5X diagnostic concentrations) علبة 5 0
أوراق مشبعة بمبيد قياسي بيرميثرين 2 025 1 مستلزمات تشخيصية Permethrin 0.25% (5X diagnostic concentrations) علبة 6 0
أوراق مشبعة بمبيد قياسي بيرميثرين 2 04 1 مستلزمات تشخيصية Permethrin 0.4% (5X diagnostic concentrations) علبة 7 0
أوراق مشبعة بمبيد قياسي بيرميثرين 2 075 1 مستلزمات تشخيصية Permethrin 0.75% (5X diagnostic concentrations) علبة 8 0
أورا ق مشبعة بمبيد قياسي بريبنايل بيوتوكسيد 2 1 مستلزمات تشخيصية PBO 4.0% (5X diagnostic concentrations) علبة 9 0
أوراق مشبعة بمبيد قياسي فينيتروثيون 2 1 مستلزمات تشخيصية Fenitrothion (5X diagnostic concentrations) علبة 10 0
أوراق مشبعة بمبيد قياسي كاربوسولفان 2 1 مستلزمات تشخيصية Carbosulfan 0.4% (5X diagnostic concentrations) علبة 11 0
أوراق مشبعة بمبيد قياسي كلوربيريفوس إيثيل 2 1 مستلزمات تشخيصية Chlorpyrifos-ethyl 1% (5X diagnostic concentrations) علبة 12 0
زيت الأوليف القياسي 2 1 مستلزمات تشخيصية Control in olive oil (OP/C control) (5X diagnostic concentrations) علبة 13 0
زيت السيليكون القياسي 2 1 مستلزمات تشخيصية Control in silicone oil (PY and PBO control) (5X diagnostic concentrations) علبة 14 0
أوراق مشبعة بمبيد قياسي مالاثيون 3 15 1 مستلزمات تشخيصية Malathion 1.5% (10X diagnostic concentrations) علبة 15 0

15 بند

جدول 44 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أوراق مشبعة بمبيد قياسي مالاثيون 3 5 1 مستلزمات تشخيصية Malathion 5% (10X diagnostic concentrations) علبة 1 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 3 60mgm2 1 مستلزمات تشخيصية Pirimiphos-methyl 60mg/m2 (10X diagnostic concentrations) علبة 2 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 3 100mgm2 1 مستلزمات تشخيصية Pirimiphos-methyl 100mg/m2 (10X diagnostic concentrations) علبة 3 0
أوراق مشبعة بمبيد قياسي بيريميفوس ميثيل 3 170mgm2 1 مستلزمات تشخيصية Pirimiphos-methyl 170mg/m2 (10X diagnostic concentrations) علبة 4 0
أوراق مشبعة بمبيد قياسي ألفا سايبرميثرين 3 005 1 مستلزمات تشخيصية Alpha-cypermethrin 0.05% (10X diagnostic concentrations) علبة 5 0
أوراق مشبعة بمبيد قياسي ألفا سايبرميثرين 3 15 1 مستلزمات تشخيصية Alpha-cypermethrin 1.5% (10X diagnostic concentrations) علبة 6 0
أوراق مشبعة بمبيد قياسي سايفلوثرين 3 1 مستلزمات تشخيصية Cyfluthrin 0.15% (10X diagnostic concentrations) علبة 7 0
أوراق مشبعة بمبيد قياسي دلتاميثرين 3 0025 1 مستلزمات تشخيصية Deltamethrin 0.025% (10X diagnostic concentrations) علبة 8 0
أوراق مشبعة بمبيد قياسي دلتاميثرين 3 003 1 مستلزمات تشخيصية Deltamethrin 0.03% (10X diagnostic concentrations) علبة 9 0
أوراق مشبعة بمبيد قياسي إيتوفينبروكس 3 1 مستلزمات تشخيصية Etofenprox 0.5% (10X diagnostic concentrations) علبة 10 0
أوراق مشبعة بمبيد قياسي لامدا سايهالوثرين 3 005 1 مستلزمات تشخيصية Lambda-cyhalothrin 0.05% (10X diagnostic concentrations) علبة 11 0
أوراق مشبعة بمبيد قياسي لامدا سايهالوثرين 3 0025 1 مستلزمات تشخيصية Lambda-cyhalothrin 0.025% (10X diagnostic concentrations) علبة 12 0
أوراق مشبعة بمبيد قياسي بيرميثرين 3 025 1 مستلزمات تشخيصية Permethrin 0.25% (10X diagnostic concentrations) علبة 13 0
أوراق مشبعة بمبيد قياسي بيرميثرين 3 04 1 مستلزمات تشخيصية Permethrin 0.4% (10X diagnostic concentrations) علبة 14 0
أوراق مشبعة بمبيد قياسي بيرميثرين 3 075 1 مستلزمات تشخيصية Permethrin 0.75% (10X diagnostic concentrations) علبة 15 0

15 بند

جدول 45 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
أوراق مشبعة بمبيد قياسي بريبنايل بيوتوكسيد 3 1 مستلزمات تشخيصية PBO 4.0% (10X diagnostic concentrations) علبة 1 0
أوراق مشبعة بمبيد قياسي فينيتروثين 3 1 مستلزمات تشخيصية Fenitrothion (10X diagnostic concentrations) علبة 2 0
أوراق مشبعة بمبيد قياسي كاربوسولفان 3 1 مستلزمات تشخيصية Carbosulfan 0.4% (10X diagnostic concentrations) علبة 3 0
أوراق مشبعة بمبيد قياسي كلوربايريفوس إيثيل 3 1 مستلزمات تشخيصية Chlorpyrifos-ethyl 1% (10X diagnostic concentrations) علبة 4 0
زيت الأوليف القياسي 3 1 مستلزمات تشخيصية Control in olive oil (OP/C control) (10X diagnostic concentrations) علبة 5 0
زيت السيليكون القياسي 3 1 مستلزمات تشخيصية Control in silicone oil (PY and PBO control) (10X diagnostic concentrations) علبة 6 0
محلول مبيد قياسي مالاثيون 5 مستلزمات تشخيصية Malathion (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 7 0
محلول مبيد قياسي تيميفوس 5 مستلزمات تشخيصية Temephos (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 8 0
محلول مبيد قياسي فينيتروثيون 5 مستلزمات تشخيصية Fenitrothion (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 9 0

9 بند

جدول 46 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
محلول مبيد قياسي كلوربايريفوس إيثيل 5 مستلزمات تشخيصية Chlorpyrifos ethyl (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 1 0
محلول إيثانول قياسي 5 مستلزمات تشخيصية Control (99.8% ethanol) (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 2 0
محلول مبيد قياسي بروموفوس 5 مستلزمات تشخيصية Bromophos (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 3 0
محلول مبيد قياسي فينثيون 5 مستلزمات تشخيصية Fenthion (Insecticide/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 4 0
محلول مبيد قياسي دايفلوبينزورون 5 مستلزمات تشخيصية Diflubenzuron (Insect development inhibitors IGR/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 5 0
محلول مبيد قياسي ترايفلومورون 5 مستلزمات تشخيصية Triflumuron 25% (Insect development inhibitors IGR/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 6 0
محلول مبيد قياسي ميثوبرين 5 مستلزمات تشخيصية Methoprene (Insect development inhibitors IGR/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 7 0
محلول مببيد قياسي سبينوساد 5 مستلزمات تشخيصية Spinosad 7.48 (Insect development inhibitors IGR/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 8 0
محلول مبيد قياسي باسيلاس ثورينجينسيس 5 مستلزمات تشخيصية B.t.i (Insect development inhibitors IGR/control solutions (serial dilutions for larval susceptibility tests, 50 ml bottle per concentration) قارورة 9 0

9 بند

جدول 47 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtPCR للكشف عن الحمى الصفراء يتوافق مع أجهزة شركة API Roche Biorad 238 مستلزمات تشخيصية YELLOW FEVER VIRUS Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of YELLOW FEVER VIRUS contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 1 0
طقم rtPCR للكشف عن فيروس الشيكونجونيا يتوافق مع أجهزة شركة API Roche Biorad 238 مستلزمات تشخيصية CHIKV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Chikungunya virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 2 0
طقم rtPCR للكشف عن فيروس زيكا يتوافق مع أجهزة شركة API Roche Biorad 238 مستلزمات تشخيصية Zika Virus Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Zika virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 3 0
طقم rtPCR للكشف عن حمى الضنك يتوافق مع أجهزة شركة API Roche Biorad 238 مستلزمات تشخيصية DENGV Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Dengue virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 4 0
طقم rtPCR للكشف عن حمى الخرمة يتوافق مع أجهزة شركة API Roche Biorad 238 مستلزمات تشخيصية Alkhurma hemorrhagic fever virus Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of Alkhurma hemorrhagic fever virus contains all reagents and controls: (contains PCR Master Mix, lyophilized primer/probe(taqman applcation) compatible with Roche,BioRad,ABI machines, Internal extraction control ,Endogenous control ,PCR grad water,Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target., 100 tests Supply with quality control certificate and validation report data. إختبار 5 0

5 بند

جدول 48 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم لتشريح الحشرات 5 تجهيزات مخبرية Insect dissecting set: High-quality dissecting kit. With well-made stainless steel tools. This kit is designed for those who perform close. Careful work with very small specimens, frequently under magnification. The 18-piece kit contains: Forcep, SS, straight tip, fine point, Forcep, SS, curved tip, fine point, Forcep, SS, Straight, Swiss style, Forcep, SS, curved, Swiss style, Forcep, SS, straight tip, 3 teeth, Scalpel hundle No. 3, Scalpel blades, 2 each Nos. 10, 11, 12, Scissors, dissecting, straight, Scissors, dissecting, curved, Pin holder/Minuten holder, very fine, Ruler, transparent, 6”, Case, flexible plastic طقم 1 0
عدسة تكبير يدوية قطرها 5 سنتميتر حسب المواصفات 5 تجهيزات مخبرية 5cm Handheld Magnifying Glass Lens 60X Magnification حبة 2 0
عدسة تكبير يدوية قطرها 5 سنتميتر حسب المواصفات 5 تجهيزات مخبرية 5cm Handheld Magnifying Glass Lens 40X Magnification حبة 3 0
عدسة تكبير يدوية قطرها 5 سنتميتر حسب المواصفات 5 تجهيزات مخبرية 5cm Handheld Magnifying Glass Lens 20X Magnification حبة 4 0
لمبة إضاءة مكتبية بحامل و بضوء أبيض 5 تجهيزات مخبرية Desk lamp with holder and white light جهاز 5 0
فرشة شعر الجمال لنقل وفحص الحشرات مقاس 2 2 تجهيزات مخبرية Camel hair brush size 2, used to pick up and handle small insects when collecting or working at Lab bench. Brushes have wood handle with metal ferrules and pointed shape tips. درزن 6 0
فرشة شعر الجمال لنقل وفحص الحشرات مقاس 2 4 2 تجهيزات مخبرية Camel hair brush size 2.4, used to pick up and handle small insects when collecting or working at Lab bench. Brushes have wood handle with metal ferrules and pointed shape tips. درزن 7 0
ملقاط صغير ذو رأس ناعم 24 تجهيزات مخبرية Small tweezers with soft tip حبة 8 0
مقصات صغيرة لقص الأوراق المقوى 24 تجهيزات مخبرية Small scissors for cutting cardboard حبة 9 0
ورق ليبل مقوى 2 متر 5 تجهيزات مخبرية cardboard label paper (2 meter) حبة 10 0
غراء عديم اللون لتثبيت الورق المقوى 24 تجهيزات مخبرية Colorless glue for fixing cardboard حبة 11 0
أقلام ليبل بحجم 0 5ملم 24 تجهيزات مخبرية 0.5mm label pens حبة 12 0
كرات النفثالين لطرد الحشرات 14 تجهيزات مخبرية Naphthalene balls for insect repellent عبوة 13 0
قوارير زجاجية بأحجام مختلفة لحفظ عينات الأمراض الحيوانية 50و100و250و500و1000 مللتر 48 تجهيزات مخبرية Glass bottles of different sizes to preserve animal disease samples (50, 100, 250, 500, 1000) ml قارورة 14 0

14 بند

جدول 49 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
صندوق من الكرتون المقوى لحفظ الحشرات 48 تجهيزات مخبرية Hard box for insect storage: Materials: heavy cardboard covered with black embossed paper outside; white paper lining inside; 5/16” white polyethylene foam pinning bottom. Construction: stayed corner joints; cover with nickel plated hinges overlaps neck. Dimensions: 10-1/8 x 12 x 2-1/2 O.D. (258 X 305 X 64 mm); 1-7/8” (48mm) inside depth حبة 1 0
صندوق بلاستيك لحفظ شرائح المجهر 5 تجهيزات مخبرية Microscope slide without labeling side: Sturdy blue plastic box holds 25 microscope slides (3 x 1”, 76 x 25mm). It has a tight-fitting cover, with reference sheet inside the lid. Top of the lid has a lip to allow secure stacking. Numbers 1 through 25 are molded on the bottom. Dimentions: 4-1/4 x 3-1/4 x 1-1/4” (108 x 83 x 32mm). حبة 2 0
صندوق بلاستيك لحفظ شرائح المجهر ذو واجهة توضح أرقام الشرائح 12 تجهيزات مخبرية Microscope slide box with side with labeling side: Durable red, high impact polystyrene microscope slide box holds 100 (3 x 1”, 76 x 25mm) slides. Box is lined with cork pads, and a printed index lines the hinged cover. Nickel-plated catch is provided. Dimensions: 8-5/16 x 6-3/4 x 1-5/16” (211 x 171 x 34 mm). حبة 3 0
خزانة لحفظ شرائح المجهر 2 تجهيزات مخبرية Microscope slide storage cabinet: The cabinet is constructed of pinewood finished medium density fiberboard and holds up to 20 slide trays. Slide trays are fabricated of anodized aluminum. They have a front label holder and a finger-friendly slide compartment separator. Each slide tray holds twenty 3 x 1” microscope slides, and trays are available separately. Cabinet dimensions: 12.8” deep, 11” wide, 10.8” high (32.5 x 20 x 27.5 cm). cabinet weight: 8.4 lbs. (3.8 kg). tray dimensions: 11.3” deep, 7.2” wide, 28: high (28.6 x 18.3 x 0.7 cm). tray weight: 0.24 lb. حبة 4 0
صندوق شمت الخشبي لحفظ الحشرات 14 تجهيزات مخبرية Fine hardwood Schmitt box (insect entomological box): Made from fine hardwood, tight fit of top to bottom sections of the box frame. Interior sides have white lining, and pinning bottom is soft but dense plastazote foam. Exterior is protected with multiple coats of clear gloss acrylic, with hinges at the back and hooks on the sides. Construction: joints mitered and reinforced with concealed steel splines; shoulders are integral part of one piece box frame; white finish on interior sides; exterior spray finished with multiple coats of sealer and clear glossy acrylic. Dimensions: 60x40x18 cm. حبة 5 0
صندوق لعرض الحشرات مقاس 8 5 في6 5 بوصة 10 تجهيزات مخبرية Display case 6.5x8.5 inches for insects: The display cases offer an economical means for effective display of specimens. They are made of double strength cardboard frames covered with black embossed paper, and are entirely lined with white paper. Cases have glass tops, and 5/16” polyethylene foam pinning bottoms. They are 2-1/4” (5.8 cm) deep outside, and from top of foam to glass inside, 1-9/16” (40 mm). these display cases are not supplied with hangers for people who want to mount them on the wall. Display cases required: 6.5x8.5 inches. حبة 6 0
خزانة لحفظ صناديق الحشرات 2 تجهيزات مخبرية Insect box storage cabinet: Iron cupboard 180x150x25 cm, with 8 shelves inside and lockable door. حبة 7 0
دواليب زجاجية لعرض الحشرات 3 تجهيزات مخبرية Display glass cupboard for insects: Used for insects display in the insect museum. The cupboard is 50 x 50 x 160 cm with 50 x 50 x 50 iron base. The four sides are made of 6-8 mm thick glass, with iron frame. The cupboard consists of 3 glass shelves (50 x 50 x 0.5 cm) with a lockable glass door. The vertical distance between each two successive shelves is 35-40 cm. The cupboard should be designed according to the international standards. حبة 8 0
دواليب زجاجية حائطية لعرض الحشرات 3 تجهيزات مخبرية Display wall glass cupboards for insects: Used for insects display in the insect museum. Each cupboard is 150 H x 100 x 25 cm with iron frame. Thick glass 6-8 mm from all sides with illumination. Each cupboard with 3 shelves inside. The vertical distance between each two successive shelves is 35-40 cm. each cupboard with a lockable glass door. The cupboard should be designed according to the international standards. حبة 9 0
دبابيس لتثبيت الحشرات 5 تجهيزات مخبرية Insect pins: Size 000,00,0,1,2,3. Small stainless steel pins, with length 2-3 cm and diameter 0.1-0.2 mm with pointed sharp end, used to pin the insects on entomological boxes. حبة 10 0
دبابيس من غير رأس لتثبيت الحشرات 24 تجهيزات مخبرية Minuten pins: Minute stainless steel pins, length 2-3 cm., 0.2 mm diameter, without head. حبة 11 0
مكعبات لتدبيس الحشرات ثلاثية المستويات 24 تجهيزات مخبرية Three steps pinning blocks for insects: Soft wood block, about 15x10x15 cm with 3 stair steps. Height decreases from 15 cm to 10 and 5 cm in each stair step respectively, wood easily penetrable by pins, with a pin hole in each stair step. حبة 12 0

12 بند

جدول 50 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
اقفاص تربية بعوض بالغ 18x 18x x 18 بوصة 14 تجهيزات مخبرية Collapsible mosquito rearing cages 18”x18”x18”: Lightweight aluminum frame and 20x20 mesh aluminum screening. The escape-proof nylon feeding hammock enables exposure of animal for blood feeding without risk of mosquitos escaping. Easy access inside the cage is provided by a knitted polyster stockinette sleeve. Sucrose solutions on cotton balls can be fed to mosquitoes through the hammock with sugar not coming in contact with metal parts. Cages are hinged for easy collapsing and storage, and are disassembled quickly for cleaning. One side is fabricated with a clear panel. For the side with stockinette access is made with clear panels in the left half and top portion of the right half above the stockinette acess. حبة 1 0
اقفاص تربية بعوض بالغ 12x x 12 x 12 بوصة 14 تجهيزات مخبرية Collapsible mosquito rearing cages 12”x12”x12”: Lightweight aluminum frame and 20x20 mesh aluminum screening. The escape-proof nylon feeding hammock enables exposure of animal for blood feeding without risk of mosquitos escaping. Easy access inside the cage is provided by a knitted polyster stockinette sleeve. Sucrose solutions on cotton balls can be fed to mosquitoes through the hammock with sugar not coming in contact with metal parts. Cages are hinged for easy collapsing and storage, and are disassembled quickly for cleaning. One side is fabricated with a clear panel. For the side with stockinette access is made with clear panels in the left half and top portion of the right half above the stockinette acess. حبة 2 0
صواني تربية يرقات البعوض 45 x 30 x 6 cm 12 تجهيزات مخبرية Mosquito Larval rearing trays: (45 x 30 x 6 cm.) Made from high impact polyethylene, (45x30x6 cm). Trays are used for larval rearing. The surface is smooth and easy to clean. The lightweight trays do not chip, with clear rigid vinyl covers. Cover, clear vinyl for 1426B Larval Tray. حبة 3 0
صواني تربية يرقات البعوض 30 x 25 x 4 5 cm 17 تجهيزات مخبرية Mosquito Larval rearing trays: (30 x 25 x 4.5 cm.) Made from high impact polyethylene, (30x25x4.5 cm). Trays are used for larval rearing. The surface is smooth and easy to clean. The lightweight trays do not chip, with clear rigid vinyl covers. Cover, clear vinyl for 1426B Larval Tray. حبة 4 0
صواني تربية يرقات البعوض 25 x 20 x 4 4 cm 10 تجهيزات مخبرية Mosquito Larval rearing trays: Made from high impact polyethylene, (25 x 20 x 4.4 cm). Trays are used for larval rearing. The surface is smooth and easy to clean. The lightweight trays do not chip, with clear rigid vinyl covers. Cover, clear vinyl for 1426B Larval Tray. حبة 5 0

5 بند

جدول 51 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
زوج بادئات التعرف على بعوض الإيديس 2 تجهيزات مخبرية Pair of primers for Aedes mosquito forward AUF (25 nanomol) زوج بادئات 1 0
بادئات التعرف على بعوض الإيديس فيتاتس 1 تجهيزات مخبرية Primers for Aedes vittatus mosquito (25 nanomol) عبوة 2 0
بادئات التعرف على بعوض الإيديس ألبوبيكتس 1 تجهيزات مخبرية Primers for Aedes albopictus mosquito (25 nanomol) عبوة 3 0
بادئات التعرف على بعوض الإيديس إيجيبتاي 1 تجهيزات مخبرية Primers for Aedes aegypti mosquito (25 nanomol) عبوة 4 0
بادئات التعرف على بعوض الإيديس كاسبيس 1 تجهيزات مخبرية Pair of primers for Aedes caspius mosquito (25 nanomol) عبوة 5 0
مجموعة بادئات التعرف على بعوض الإيديس فيكسان 2 تجهيزات مخبرية Set of primers for Aedes vexans mosquito (25 nanomol): 4 primers عبوة 6 0
بادئات كونسينساس 1 تجهيزات مخبرية Primers for consensus CPI6 R, (25 nanomol) عبوة 7 0
بادئات التعرف على بعوض الكيوليكس بيبنز 1 تجهيزات مخبرية Primers for Culexx pipiens mosquito complex PQIO F, (25 nanomol) عبوة 8 0
زوج بادئات التعرف على بعوض الكيولكس كوينكيفيشيس 2 تجهيزات مخبرية Pair of primers for Culexx quinquefasciatus mosquito FCQ, (25 nanomol) عبوة 9 0
زوج بادئات التعرف على القراد 2 تجهيزات مخبرية Primers for 16S rRNA gene F (16S+1) Ticks (25 nanomol): 4 primers عبوة 10 0
مجموعة بادئات التعرف على فيروس طاعون الخيل الأفريقي 5 تجهيزات مخبرية Set of primers for African Horse Sickness AHS virus (25 nanomol) : 22 primers عبوة 11 0
مجموعة بادئات التعرف على فيروس اللسان الأزرق 5 تجهيزات مخبرية Set of primers for Blue tongue virus (25 nanomol): 4 primers عبوة 12 0

12 بند

جدول 52 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
خلايا بي اتش كى 3 مستلزمات مخبرية Scientific name:BHK 21 (Clone 13) Origin: Hamster kidney Growth: adherent cells Morphology: fibroblast Synonym(s): BHK-21 (C-13) Cells, BHK-21 C-13 Cells, BHK21 clone 13 Cells, BHK21-C13 Cells, BHK21/C13 Cells عبوة 1 0
خلايا الفيرو للزرع النسيجي 3 مستلزمات مخبرية Scientific name: Vero C1008 [Vero 76, clone E6, Vero+G598:G637 E6] Origin: Monkey (African green monkey kidney) Growth: adherent cells Morphology: epithelial cells Transported with dry ice Synonym(s): Vero 76 Clone E6 Cells, Vero Cells, Vero E6 Cells, VeroC1008 Cells عبوة 2 0
سيرم جنين البقر للزرع النسيجي عبوة 500 مل 11 مستلزمات مخبرية FOETAL CALF SERUM: 500ML/BOTTLE Sterile filtered suitable for cell culture (mammals) عبوة 3 0
سيرم عجول حديثي الولادة للزرع النسيجي عبوة 500 مل 14 مستلزمات مخبرية Newborn calf serum: 500 ml/bottle Sterile-filtered suitable for cell culture (mammals) عبوة 4 0
البومين ابقار Fraction V للزرع النسيجي 3 مستلزمات مخبرية Bovine Serum Albumin Fraction V (BSA): Cell Culture Grade Derived from bovine serum, lyophilized, suitable for cell culture (mammals), molecular weight ~66, 50 gm/vial عبوة 5 0
وسط غذائي لتجميد وحفظ الخلايا بالدمسو 4 مستلزمات مخبرية Cell Freezing Medium-Dmso 1×: contain MEM with fetal and calf serum plus 10% DMS, sterile-filtered and suitable for cell culture (mammals) 50 ml/bottle عبوة 6 0
وسط غذائي لتجميد وحفظ الخلايا بالجليسرول 4 مستلزمات مخبرية Cell Freezing Medium-Glycerol 1×: contain MEM with fetal and calf serum plus 10% Glycerol, sterile-filtered and suitable for cell culture (mammals) 50 ml/bottle عبوة 7 0
وسط لزراعة الميكروبات اللاهوائية 2 مستلزمات مخبرية Thioglycollate broth: Powder, 500 gm/bottle عبوة 8 0
وسط غذائي سائل لزراعة الخلاياGMEM 17 مستلزمات مخبرية Glasgow minimum essential medium:Liquid medium containing sodium bicarbonate and L-glutamine, sterile-filtered, suitable for cell culture (mammals), 500 ml/bottle عبوة 9 0
بدرة وسط غذائي لزراعة الخلاياGMEM 9 مستلزمات مخبرية Glasgow minimum essential medium: Powdered medium with L-glutamine and without sodium bicarbonate and tryptose phosphate broth, 10 litre/bottle عبوة 10 0
تربيتوز فوسفيت بروث 3 مستلزمات مخبرية Tryptose phosphate broth: Powdered additive used for cell culture media and for growth of fastidious microorganism, 500 gm/bottle عبوة 11 0
وسط غذائي 199 لزراعة الخلايا 6 مستلزمات مخبرية Medium 199: Liquid medium, sterile-filtered, suitable for cell culture (mammals) with sodium bicarbonate, L-glutamine and HEPES buffer, 500 ml/bottle عبوة 12 0
وسط غذائي 199 مع ايرلس لزراعة الخلايا 6 مستلزمات مخبرية Medium 199: Liquid medium with Earle`s salt, sterile-filtered, suitable for cell culture (mammals) with sodium bicarbonate and L-glutamine buffer, 500 ml/bottle عبوة 13 0
وسط غذائي لزراعة الخلايا مع الهيبزMEDIUM RPM1 1640 6 مستلزمات مخبرية RPM1 1640 MEDIUM: Liquid medium, sterile filtered, suitable for cell culture (mammals) with sodium bicarbonate, L-glutamine and HEPES buffer, 500 ml/bottle عبوة 14 0
وسط غذائي لزراعة الخلايا RPM1 1640 MEDIUM 3 مستلزمات مخبرية RPM1 1640 MEDIUM: Liquid medium, sterile filtered, suitable for cell culture (mammals) with sodium bicarbonate and L-glutamine, 500 ml/bottle عبوة 15 0

15 بند

جدول 53 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
محلول منظم هيبس 100 ملbottle 3 مستلزمات مخبرية م HEPES solution: 1M solution, sterile-filtered, suitable for cell culture (mammals), pH 5.0-6.01, 100 ml/bottle عبوة 1 0
بدرة منظم ترس 100 ملbottle 1 مستلزمات مخبرية Trizma® base Synonym(s): 2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Tris(hydroxymethyl)aminomethane, Trometamo: Powder, linear formula NH2C(CH2OH)3 , Molecular wt 121.14, suitable for cell culture (mammals), 99.9%≥(titration), 100 gl/bottle عبوة 2 0
محلول تريبسين اديتا 100 مل عبوة 9 مستلزمات مخبرية Trypsin-EDTA solution: 0.25% solution, sterile-filtered, suitable for cell culture (mammals), containing 2.5 gm trypsine and 0.2 gm EDTA per one litre of HBSS with phenol red, 100 ml/bottle عبوة 3 0
بودرة تريبسين 25 1 عبوة 250 جم 4 مستلزمات مخبرية Trypsin 1:250 Powder 1000-1500 BAEE units/mg, suitable for use in cell culture, 250 gm/bottle عبوة 4 0
بدرة اديتا 500 جم عبوة 2 مستلزمات مخبرية Ethylenediaminetetraacetic acid disodium salt dehydrate Synonym(s): Disodium ethylenediaminetetraacetate dihydrate, EDTA disodium salt, EDTA-Na2, Edathamil, Edetate disodium salt dihydrate, Sequestrene Na2 (Analytical reagent) Linear formula C10H14N2Na2O8 · 2H2O Molecular wt 372.24, 500 gm/bottle عبوة 5 0
محلول فينول رد احمر 100 مل عبوة 2 مستلزمات مخبرية Phenol red solution: 0.5% solution, sterile-filtered, suitable for use in cell culture, 100 ml/bottle عبوة 6 0
بودرة فينول رد 5 ملجم عبوة 2 مستلزمات مخبرية Phenol Red sodium salt: Powder, suitable for cell culture for use as indicator for pH, linear formula C19H13NaO5S, molecular wt 376.36, 5 gm/vial عبوة 7 0
بنسلين مائي Penecillin G وحدة2000000عبوة 86 مستلزمات مخبرية Penecillin: water soluble, for I/M and I/V injection, 2000000/vial عبوة 8 0
استربتومايسين Streptomycin عبوة 1مل جم 43 مستلزمات مخبرية Streptomycin powder: for IM injection, 1 gm/vial عبوة 9 0
جنتاميسينGentamycine 10 مل عبوة 43 مستلزمات مخبرية Gentamycin sulphate solution: Broad spectrum antibiotic, sterile filtered, suitable for cell culture, Conc. 10mg/ml, 10 ml/vial عبوة 10 0
مايكوستاتين 50ملجم عبوة 43 مستلزمات مخبرية Mycostatin vial, Nystatin powder, sterilized by γ irradiation, suitable for cell culture, linear formula C47H75NO17, molecular wt 926.1, 50mg/vial عبوة 11 0
فنجيزون 100Amphotercin B Fungizone مل عبوة 26 مستلزمات مخبرية Amphotericin B. 250ug/ml in deionized water, sterilized by filtration, suitable for cell culture (mammals), molecular wt 924.08, 100ml/vial عبوة 12 0
داي مثايل سلف وكسايد دمسو 100مل عبوة 5 مستلزمات مخبرية Dimethyl sulfoxide (DMSO):Linear formula (CH3)2SO, molecular wt 78.13, used for cell freezing and storage 100ml/bottle عبوة 13 0
جليسرول 99    250 مل عبوة 10 مستلزمات مخبرية (GC) ≥99% Glycerol: Linear formula HOCH2CH(OH)CH2OH molecular wt 92.09 250 ml/bottle عبوة 14 0
منظف دكون 90 عبوة4 لتر 29 مستلزمات مخبرية Detergent (Decon 90) عبوة 15 0

15 بند

جدول 54 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
قارورة زراعة الخلايا مساحة سطح الزراعة225سم2 14 مستلزمات مخبرية Corning® cell culture flask: Sterile, surface area 225 cm2, polystyren, surface treated for cell binding, with screw cap, 25 piece /bag عبوة 1 0
قارورة زراعة الخلايا مساحة سطح الزراعة75سم2 7 مستلزمات مخبرية Corning® 75 cm² U-shape cell culture flask: Sterile, polystyren, surface (75 cm²) treated for cell binding, with screw cap and canted neck, 100 piece/bag عبوة 2 0
قارورة زراعة الخلايا مساحة سطح الزراعة 25 سم2 2 مستلزمات مخبرية Corning® cell culture flasks: Sterile, polystyren, surface 25 cm², treated for cell binding, with screw cap, 500 piece/bag عبوة 3 0
اطباق زراعة الأنسجة مسطحة القاع 7 مستلزمات مخبرية Falcon® 96-well Clear Flat Bottom TC-treated Culture Microplate, with Lid, Individually Wrapped, Sterile, 50/Case عبوة 4 0
فلم لاصق لاطباق الزراعة 9 مستلزمات مخبرية Nunc® breathable cell culture sealing film: Sterile, 50/bag عبوة 5 0
انابيب بوليستيرين لزراعة الخلايا مسطحة القاع مع غطاء 2 مستلزمات مخبرية Culture tube flat surface Nunc - ø x l: 16 x 110 mm: Sterile, polystyrene, surface treated for cell attachment, with screw cap, 450/bag عبوة 6 0
انابيب زراعة مقاس 16 في 110 ملميتر 6 مستلزمات مخبرية Pyrex® glass culture tubes: non-sterile, with screw cap and round bottom, 40 piece/bag عبوة 7 0
حامل انابيب زراعة الخلايا 7 مستلزمات مخبرية Slant rack for culture tubes: For 15-16mm tube (hold 40xtube), 4 pieces/bag عبوة 8 0
مسحات لجمع عينات الفيروسات 17 مستلزمات مخبرية FLOCKED STERILE SWABS FOR VIROLGY SPECIMENS WITH MEDIUM 100 piece/bag عبوة 9 0
طقم تشريح حيوانات صغيرة 9 مستلزمات مخبرية Stainless steel dissecting set for laboratory animals: Small animal dissecting set: the set contains one each of the following: Dissection Scissors, Sharp/Blunt, Straight Mayo Dissection Scissors, Straight Iris Scissors, Straight General Dissection Forceps, Serrated Tips Iris Tissue Forceps, Fine Point 4.5″ Hemostatic Kelley Forceps Hemostatic Rochester Pean Forceps, Straight Double Prong Flesh Hooks Section Lifter Single Ended Blade Handle Ruler طقم 10 0
قفاز يد للحماية من البرودة والنتروجين السائل حجم كبير 14 مستلزمات مخبرية قفاز يد للحماية من البرودة والنتروجين السائل (حجم كبير) Hand gloves: For protection against cold temperature and liquid nitrogen vapour (large size عبوة 11 0
حافظات محمولة لحفظ العينات مع أوعية ثلج 10لتر 6 مستلزمات مخبرية حافظات محمولة لحفظ العينات مع أوعية ثلج (10 لتر) Portable containers for sample transport with 10 suitable ice pads: For preservation of clinical samples during transportation (6-10 L capacity) made from PP material, non toxic, temperature range 2-8°C, storage time > 48 hour عبوة 12 0
حاوية نيتروجين سائل 3 مستلزمات مخبرية High-Capacity Small freezer with a 38L LN2 capacity and ten 11" canisters. With numbered index ring and tapered internal canister locator. 2 mL Vial Capacity: 1140 With all optional accessories: 11th canister, spare necktube core, roller base, CRYO-SENTRY Low Level Alarm عبوة 13 0
صبغة نيوترال حمراء 10 مستلزمات مخبرية • Neutral red (solid) (25 g/ pack) عبوة 14 0
صبغة الكريستال القرمزية 5 مستلزمات مخبرية • Crystal violet (solid; Certified Biological Stain) (25 g/ pack) عبوة 15 0

15 بند

جدول 55 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
محلول هانكس الملحي المتوازن 11 مستلزمات مخبرية Hanks balanced salt solution: with sodium bicarbonate and phenol red, without calcium chloride and magnesium phosphate, sterile-filtered and suitable for cell culture (mammals) 500 ml/bottle عبوة 1 0
محلول الفوسفات المنظم 14 مستلزمات مخبرية PHOSPHATE BUFFERED SALINE (PBS): pH 7.4, sterile-filtered and suitable for cell culture (mammals) 500 ml/bottle عبوة 2 0
صوديوم كلورايد 2 مستلزمات مخبرية Sodium chloride (Na Cl): suitable for use in cell culture (mammals), molecular wt 58.44, 500 gm/bottle عبوة 3 0
بودرة بيكربونات الصوديوم عبوة500 جم 2 مستلزمات مخبرية Sodium Bicarbonate powder: suitable for use in cell culture (mammals), 500 gm/bottle عبوة 4 0
بوتاسيوم كلورابد 2 مستلزمات مخبرية (KCL) Potassium chloride: suitable for use in cell culture (mammals), molecular wt 74.55, 250 gm/bottle عبوة 5 0
صوديوم فوسفيت دايبيسك داي صوديوم هايدروجين فوسفيت 2 مستلزمات مخبرية (Na2HPO4) Sodium phosphate dibasic: suitable for use in cell culture (mammals), molecular wt 141.96, 100 gm/bottle عبوة 6 0
بوتاسيوم دايهايدروجين فوسفيت 2 مستلزمات مخبرية (KH2PO4) Potassium dihydrogen phosphate: suitable for use in cell culture (mammals), molecular wt 136.09, 100 gm/bottle عبوة 7 0
محلول صوديوم بيكربونات 17 مستلزمات مخبرية Sodium bicarbonate solution: 7.5%, sterile-filtered, suitable for cell culture (mammals), 100 ml/bottle عبوة 8 0
وحدة تعقيم للأوساط الزراعية 1 مستلزمات مخبرية Filter Holder 142 mm, stainless steel Filter diameter: 142 mm Maximum pressure Inlet: 13.8 bar (200 psi) Differential: 6.9 bar (100 psi) Effective filter area: Approximately 135.2 cm2 (21 in2 Material construction: stainless steel (largely) With a set of spare parts and accessories including -PVC tubing (not autoclavable), ½ in. (12.7 mm) ID × ¹³⁄₁₆ in. (20.6 mm) OD, 3.0 m (10 ft), with 2 stainless steel clamps O-ring, silicone (4/pk)- -Back pressure support screen, stainless steel, 124 mm (1/pk) -Dispensing Pressure Vessel, (ASME code-complying, 5-liter capacity) MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other documents supplied حبة 9 0
نظام ترشيح مواد خطرة 1 مستلزمات مخبرية Filter diameter: 142 mm Filtration Area: 120 cm² Maximum Inlet Pressure, bar (psi): 6.9 bar (100 psi) Materials of Construction: 316 stainless steel; aluminum legs; molded polypropylene handwheels; PTFE seal MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other documents supplied حبة 10 0
أغشية ترشيح Millipore Filter system 0 2um 238 مستلزمات مخبرية Membrane Filter, Triton®-free, 0.22 µm pore size. 142 mm diameter, Triton®-free mixed cellulose esters (MCE) membrane, hydrophilic, white, 50 discs حبة 11 0
أغشية ترشيح 95 مستلزمات مخبرية • Carboxymethylcellulose, medium viscosity (solid) حبة 12 0

12 بند

جدول 56 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز A 11 مشخص Reference PCR Antigen for Clostridium perfringens B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز B 11 مشخص Reference PCR Antigen for Clostridium perfringens B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز D 11 مشخص Reference PCR Antigen for Clostridium perfringens D Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم بيرفرنجنز E 11 مشخص Reference PCR Antigen for Clostridium perfringens E Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم شوفياي 11 مشخص Reference PCR Antigen for Clostridium Chauvoie Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم نوفياي A 11 مشخص Reference PCR PCR Antigen for Clostridium novyi A Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 6 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم نوفياي B 11 مشخص Reference PCR Antigen for Clostridium novyi B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 7 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم سوردلى 11 مشخص Reference PCR Antigen for Clostridium sordellii Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 8 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم سيبتكم 11 مشخص Reference PCR Antigen for Clostridium septicum Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 9 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا A 11 مشخص Reference PCR Antigen for pasteurella multocida A Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 10 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا D 11 مشخص Reference PCR Antigen for pasteurella multocida D Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 11 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا B 11 مشخص Reference PCR Antigen for pasteurella multocida B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 12 0
انتيجين مرجعي لبكتيريا الباستيريلا مالتوسيدا E 11 مشخص Reference PCR Antigen for pasteurella multocida E Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 13 0
انتيجين مرجعي لبكتيريا مانهيميا هيموليتكا 11 مشخص Reference PCR Antigen for Mannheimia Haemolytica Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 14 0
انتيجين مرجعي لبكتيريا مانهيميا ترهالوسي 11 مشخص Reference PCR Antigen for Mannheimia Haemolytica Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 15 0

15 بند

جدول 57 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لبكتيريا بروسيلا ميلتنسس 11 مشخص Reference PCR Antigen for Brucella melitensis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
أنتجين مرجعيى لبكتيريا بروسيلا أوفيس 11 مشخص Reference PCR strain for Brucella ovis, non infectious, lypholized , fully identified عبوة 2 0
انتيجين مرجعي لبكتيريا بروسيلا ابورتس 11 مشخص Reference PCR Antigen for Brucella abortus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
انتجين مرجعي لبكتيريا بروسيلا عام 11 مشخص Reference PCR antigen for Brucella sp., non infectious ,lypholized,fullu identified (including concentarion) عبوة 4 0
انتيجين مرجعي لبكتيريا مايكوباكتيريوم المسببة لمرض السل البقري Mycobacterium bovis 11 مشخص Reference PCR Antigen forMycobacterium bovis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0
انتيجين مرجعي لبكتيريا السالمونيلا عام 11 مشخص Reference PCR Antigen for Salmonella Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 6 0
انتيجين مرجعي لبكتيريا الاي كولاى عام 11 مشخص Reference PCR Antigen for E.coli Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 7 0
انتيجين مرجعي لبكتيريا الكوكسيلا بيرنيتي Coxiella burnetti 11 مشخص Reference PCR Antigen for Coxeilla burnetii Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 8 0
انتيجين مرجعي لبكتيريا المايكوباكتيريوم باراتيوبركيلوزيس Mycobacterium paratuberculosis 11 مشخص Reference PCR Antigen forMycobacterium paratuberculosis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 9 0
انتيجين مرجعي لبكتيريا المسببة لمرض خناق الخيل Streptocous equi 11 مشخص ا Reference PCR Antigen for Strept equi Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 10 0
انتيجين مرجعي لبكتيريا المسببة لمرض الرعام في الخيلBurkholderia mallei 11 مشخص Reference PCR Antigen for Burkholderia mallei Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 11 0
انتيجين مرجعي لبكتيريا كامبيلوباكتر فيتس Campylobacter foetus 11 مشخص Reference PCR Antigen forCampylobacter foetus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 12 0
انتيجين مرجعي لبكتيريا كامبيلوباكتر ابورتس Campylobacter abrtus 11 مشخص Reference PCR Antigen forCampylobacter abortus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 13 0
انتيجين مرجعي لبكتيريا الكلاميديا ابورتس 11 مشخص Reference Antigen for Chlamydia abortus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 14 0

14 بند

جدول 58 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات للتعرف على بكتيريا مرض خناق الخيل في الخيل 11 مشخص بادئات للتعرف على مرض خناق الخيل في الخيلPrimers for detection of Streptococcus equi عبوة 1 0
بادئات للتعرف على بكتيريا مرض نظير السل 11 مشخص بادئات للتعرف على بكتيريا مرض نظير السل Primers for detection of Mycobacterium paratuberculosis عبوة 2 0
بادئات للتعرف على بكتيريا مرض السل البقري 11 مشخص بادئات للتعرف على بكتيريا مرض السل البقري Primers for detection of Mycobacterium bovis عبوة 3 0
بادئات للتعرف على بكتيريا كلاميدوفيليا ابورتس 11 مشخص بادئات للتعرف على بكتيريا كلاميدوفيليا ابورتس Primers for detection of Chlamdophilia abortus عبوة 4 0
بادئات لمجموعة المايكوبلازما مايكويدس 11 مشخص Primers for detection of Mycoplasma mycoides cluster specific primers: •5’-TTCTAAATTAGTTACTCGTGCA- 3’ •5’- AATAAACTGTATTCTCTAGCCA- 3’ عبوة 5 0
بادئات للمايكوبلازما كابري كولم تحت فصيلة كابرينيوموني 11 مشخص Mycoplasma capricolum subspecies capripneumoniae primers: F: 5’-ATC-ATT-TTT-AAT-CCC-TTC-AAG-3’-R: 5’-TAC-TAT-GAG-TAA-TTA-TAA-TAT-ATG-CAA-3’ عبوة 6 0
بادئات للتعرف على بكتيريا مايكوبلازما مايكويديس تحت النوع مايكويديس 11 ادئات للتعرف على بكتيريا مايكوبلازما مايكويديس تحت النوع مايكويديس Primers for detection of Mycoplasma mycoidesssubspecies mycoides عبوة 7 0
بادئات للتعرف على بكتيريا مايكوبلازما اوفنيموني 11 مشخص بادئات للتعرف على بكتيريا مايكوبلازما اوفنيموني Primers for detection of Mycoplasma ovipneumoniae عبوة 8 0
بادئات للتعرف على بكتيريا الباستيريلا مالتوسيدا A 11 مشخص Primers for detection of Pasteurella multocida A Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 9 0
بادئات للتعرف على بكتيريا الباستيريلا مالتوسيدا D 11 مشخص Primers for detection of Pasteurella multocida D Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 10 0
ابادئات للتعرف على بكتيريا الباستيريلا مالتوسيدا B 11 مشخص Primers for detection of Pasteurella multocida B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 11 0
انتيجين مرجعي بكتيريا الباستيريلا مالتوسيدا E 11 مشخص Primers for detection of Pasteurella multocida E Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 12 0
بادئات للتعرف على بكتيريا مانهيميا هيموليتكا 11 مشخص Primers for detection of Mannheimia Haemolytica Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 13 0
بادئات للتعرف على بكتيريا باستيرلا ترهالوسي 11 مشخص Primers for detection of Pasteurella trehalose Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 14 0
بادئات للتعرف على باكتيريا كامبيلوباكتر فيتس 11 مشخص Primers for detection of Campylobacter foetus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 15 0

15 بند

جدول 59 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات للتعرف على بكتيريا كلوستريديم برفرنجز 11 مشخص Primers for detection of Clostridium perfringens bacteria, Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 1 0
بادئات للكشف عن جين سم الفا بكتيريا كلوستريديم برفرنجز 11 مشخص Primers for detection of Clostridium perfringens alpha toxin gene Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 2 0
بادئات للكشف عن جين سم بيتا بكتيريا كلوستريديم برفرنجز 11 مشخص Primers for detection of Clostridium perfringens Beta toxin gene Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 3 0
بادئات للكشف عن جين سم أبسلون بكتيريا كلوستريديم برفرنجز 11 مشخص Primers for detection of Clostridium perfringens epsilon toxin gene Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
بادئات للكشف عن جين سم دلتا بكتيريا كلوستريديم برفرنجز 11 مشخص Primers for detection of Clostridium perfringens Delta toxin gene Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 5 0
بادئات للكشف عن جين سم انتروتوكسين بكتيريا كلوستريديم برفرنجز 11 مشخص Primers for detection of Clostridium perfringens enterotoxin n gene Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 6 0
بادئات للتعرف على بكتيريا بروسيلا 11 مشخص Primers for detection of Brucella species Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 7 0
بادئات للتعرف على بكتيريا بروسيلا ابورتس 11 مشخص Primers for detection of Brucella abortus Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 8 0
بادئات للتعرف على بكتيريا ملتنسيس 11 مشخص Primers for detection of Brucella meletensis Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 9 0
بادئات للتعرف على بكتيريا كوسيلا بيرنتي 11 مشخص Primers for detection of Coxiella burnettii Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 10 0
بادئات للتعرف على بكتيريا كوراينى باكتيريم سودوتيوبركلوسس 11 مشخص Primers for detection of Corynebacterium pseudotuberculosis , Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 11 0
بادئات للتعرف على بكتيريا بروسيلا اوفيس 11 مشخص Primers for detection of Brucella ovis, Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 12 0
بادئات للتعرف على بكتيريا مرض الرعام 11 مشخص Primers for detection of Burkholderia mallei عبوة 13 0

13 بند

جدول 60 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي أحادي للبروسيلا النوع M 11 مشخص سيرم مرجعي أحادي للبروسيلا النوع (M) Anti- M monospecific sera for brucella: - Lyophilized. - 1ml/container عبوة 1 0
سيرم مرجعي أحادي مضاد للبروسيلا النوع A 11 مشخص سيرم مرجعي أحادي مضاد للبروسيلا النوع (A) Anti- A monospecific sera for brucella: - Lyophilized. - 1ml/container عبوة 2 0
سيرم مرجعي مضاد للبروسيلا النوع s 11 مشخص سيرم مرجعي مضاد للبروسيلا النوع (S) Unabsorped hyperimmune anti-S-Brucella polyclonal serum: - Lyophilized. - 1ml/container عبوة 3 0
سيرم مرجعي مضاد للبروسيلا النوع R 11 مشخص سيرم مرجعي مضاد للبروسيلا النوع (R) Unabsorped hyperimmune anti-R-Brucella polyclonal serum: - Lyophilized. - 1ml/container عبوة 4 0
سيرم مرجعى سلبى لبروسيلا أبورتس 11 مشخص Reference antisera (negative) against Brucella abortus Lyophilized. - 1ml/container- عبوة 5 0
سيرم مرجعى إيجابى قوى للبروسيلا ابورتس 11 مشخص Reference antisera (Strong) against Brucella abortus Lyophilized. - 1ml/container- عبوة 6 0
سيرم مرجعى إيجابى ضعيف للبروسيلا ا ابورتس 11 مشخص Reference antisera (weak) against Brucella abortus Lyophilized. - 1ml/container- عبوة 7 0
سيرم مرجعي أيجابى قوي لبروسيلا ملتنسيس 11 مشخص Reference antisera (Strong) against Brucella meletensis Lyophilized. - 1ml/container- عبوة 8 0
سيرم مرجعي أيجابي ضعيف لبروسيلا ملتنسيس 11 مشخص Reference antisera (weak) against Brucella meletensis Lyophilized. - 1ml/container- عبوة 9 0
سيرم مرجعي سلبي لبروسيلا ملتنسيس 11 مشخص reference antisera negative against Brucella meletensis Lyophilized. - 1ml/container- عبوة 10 0

10 بند

جدول 61 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار مانع التلازن الدموي لانفلونزا الطيور النوع أ 29 تجهيزات مخبرية Reference HI Antigen for Avian Influenza type ANon-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان 1 29 تجهيزات مخبرية Reference HI Antigen for Avian Influenza virus type H5N1 Lyophilized, Fully identified (including Antigen concentration) عبوة 2 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان2 29 تجهيزات مخبرية Reference HI Antigen for Avian Influenza virus type H5N2 Lyophilized, Fully identified (including Antigen concentration) عبوة 3 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان8 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان8 Reference HI Antigen for Avian Influenza type H5N8 Non-infectious.Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان6 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 5 ان6 Reference HI Antigen for Avian Influenza type H5N6 Non-infectious. Lyophilized, Fully identified (includingvirus concentration) عبوة 5 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور نوع أ 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type A Lyophilized, Fully identified (including Antibody concentration) عبوة 6 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 5 ان 1 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type H5N1 Lyophilized, Fully identified (including Antibody concentration) عبوة 7 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 5 ان 2 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza type H5N2 Non-infectious. Lyophilized, Fully identified (including antibdy concentration) عبوة 8 0
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة انفلونزا الطيور نوع اتش 5 إن 8 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type H5N8 Lyophilized, Fully identified (including Antibody concentration) عبوة 9 0
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة انفلونزا الطيور نوع اتش 5 إن 6 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type H5N6 Lyophilized, Fully identified (including Antibody concentration) عبوة 10 0
نتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 9 ان 2 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 9 ان 2 Reference HI Antigen for Avian Influenza type H9N2 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 11 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 7 ان1 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type H7 N1 Lyophilized, Fully identified (including Antibody concentration) عبوة 12 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان1 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان1 Reference HI Antigen for Avian Influenza type H7 N1 Non-infectious.Lyophilized, Fully identified (including virus concentration) عبوة 13 0
سيرم مرجعي مانع للتلازن الدموي للعترة أنفلونزا الطيور للعترة نوع اتش 7 ان2 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type H7N2 Lyophilized, Fully identified (including Antibody concentration) عبوة 14 0
انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان2 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي انفلونزا الطيور نوع اتش 7 ان2 Reference HI Antigen for Avian Influenza type H7N2 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 15 0

15 بند

جدول 62 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة انفلونزا الطيور نوع اتش 9 إن 2 29 تجهيزات مخبرية Reference HI Antiserum for Avian Influenza virus type H9 N2 Lyophilized, Fully identified (including Antibody concentration) عبوة 1 0
سيرم مرجعي للتلازن الدموي لمرض أنفلونزا الخيول للعترة نوع اتش 3 7 تجهيزات مخبرية Reference HI Antiserum for Equine Influenza Virus subtype type H3 Lyophilized. عبوة 2 0
انتيجين مرجعي لاختبار التلازن الدموي لمرض انفلونزا الخيول نوع اتش 3 7 تجهيزات مخبرية انتيجين مرجعي لاختبار التلازن الدموي لمرض انفلونزا الخيول نوع اتش 3 Reference HI Antigen for Equine Influenza subtype type H3 Non-infectious. Lyophilized عبوة 3 0
سيرم مرجعي مانع للتلازن الدموي للعترة ماسوشيتي M41 لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية سيرم مرجعي مانع للتلازن الدموي للعترة ماسوشيتي (M41) لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV Mass(M41) strain disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 4 0
سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا 29 تجهيزات مخبرية سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا Reference HI Antiserum for Lentogenic (LaSota ) Strain Newcastle Disease Virus Lyophilized, Fully identified (including Antibody concentration) عبوة 5 0
انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا 29 تجهيزات مخبرية انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة لاسوتا Reference HI Antiserum for Lentogenic (LaSota ) Strain Newcastle Disease Virus Lyophilized, Fully identified (including virus concentration) عبوة 6 0
سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية 29 تجهيزات مخبرية سيرم مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية Reference HI Antiserum for Mesogenic and Velogenic Newcastle Disease Virus Lyophilized, Fully identified (including Antibody concentration) عبوة 7 0
انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية 29 تجهيزات مخبرية انتيجين مرجعي مانع للتلازن الدموي لمرض النيوكاسل العترة الضارية Reference HI Antiserum for Mesogenic and Velogenic Newcastle Disease Virus Lyophilized, Fully identified (including virus concentration) عبوة 8 0
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة ماسوشيتي لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة ماسوشيتي لمرض لتهاب الشعب الهوائية في الدجاج Reference HI Antigen for IBV Mass (M41) strain. Non-infectiou . Lyophilized. Fully identified (including virus concentration) عبوة 9 0
سيرم مرجعي مانع للتلازن الدموي للعترة D274 لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية سيرم مرجعي مانع للتلازن الدموي للعترة D 274 لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV D274 strain disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 10 0
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة D274 لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة D274 (D207) لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antigen for IBV D 274 (D207) strain Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 11 0
سيرم مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية سيرم مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antiserum for IBV QX (D 388) strain disease virus Lyophilized, Fully identified (including Antibody concentration) عبوة 12 0
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة QX لمرض التهاب الشعب الهوائية في الدجاج Reference HI Antigen for IBV QX (D 388) strain Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 13 0
سيرم مرجعي مانع للتلازن الدموي للعترة 793B 491 CR88 لمرض التهاب الشعب الهوائية في الدجاج 29 تجهيزات مخبرية Reference HI Antiserum for IBV 793B (4/91, CR88) strain virus Lyophilized, Fully identified (including Antibody concentration) عبوة 14 0

14 بند

جدول 63 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة793B 491 CR88 لمرض التهاب اشعب الهوائية في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لاختبار مانع التلازن الدموي للعترة 793B (4/91, CR88) لمرض التهاب اشعب الهوائية في الدجاج Reference HI Antigen for IBV 793B (4/91, CR88) strain Noinfectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لفيروس مرض الجمبورو في الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الجمبورو في الطيور Reference Antigen for Infectious bursal Disease virus Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
سيرم مرجعي لفيروس مرض الجمبورو في الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الجمبورو في الطيور Reference Antiserum for Infectious bursal Disease virus Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
سيرم مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية Reference Antiserum for Infectious Bursal Disease virus Virulent strain (Interfield 2512 strain) Noninfectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
انتيجين مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الجمبورو في الطيور العترة الضارية (Interfield 2512 strain) Reference Antigen for Infectious Bursal Disease virus Virulent strain (Interfield 2512 strain) Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0
سيرم مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج 29 تجهيزات مخبرية سيرم مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج Reference AGID Antiserum for Mareks Disease virus in chicken. Lyophilized, Fully identified (including Antibody concentration) عبوة 6 0
انتيجين مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لاختبار الترسيب في الاجار لمرض الماريك في الدجاج Reference AGID Antigen for Mareks Disease virus in chicke . Lyophilized, Fully identified (including Antigen concentration) عبوة 7 0
سيرم مرجعي لفيروس مرض الليكوزس في الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الليكوزس في الطيور Reference Antiserum for Avian Leukosis Virus Disease Non-infectious. Lyophilized, Fully identified (including Antibody concentration) عبوة 8 0
انتيجين مرجعي لفيروس مرض الليكوزس في الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الليكوزس في الطيور Reference Antigen for Avian Leukosis virus Disease A Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 9 0
سيرم مرجعي لفيروس مرض الليكوزس في الطيور جيه 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الليكوزس في الطيور جيه Reference Antiserum for Avian Leukosis virus Disease Subtype J Non-infectious. Lyophilized, Fully identified (including antibody concentration) عبوة 10 0
انتيجين مرجعي لفيروس مرض الليكوزس في الطيور النوع جيه 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الليكوزس في الطيور النوع جيه Reference Antigen for Avian Leukosis virus Disease Subtype J Non-infectious. Lyophilized, Fully identifid (including virus concentration) عبوة 11 0
سيرم مرجعي لفيروس مرض الأدينو في الدجاج 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الأدينو في الدجاج Reference Antiserum for Fowl Adenovirus disease FAV-1 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 12 0
انتيجين مرجعي لفيروس مرض الأدينو في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الأدينو في الدجاج FAV1 Reference Antigen for Fowl Adenovirus disease FAV-1 Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 13 0
سيرم مرجعي لفيروس تدني انتاج البيض في الدجاج 29 تجهيزات مخبرية سيرم مرجعي لفيروس تدني انتاج البيض في الدجاج Reference Antiserum for Egg Drop Syndrome Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 14 0
انتيجين مرجعي لفيروس تدني انتاج البيض في الدجاج 29 تجهيزات مخبرية انتيجين مرجعي لفيروس تدني انتاج البيض في الدجاج Reference Antigen for Egg Drop Syndrome Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 15 0
بيض دجاج مخصب خالي من الامراض للعزل الفيروسي 2857 مستلزمات تشخيصية Specific pathogen free (SPF) fertile eggs:-Research quality حبة 16 0

16 بند

جدول 64 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي لفيروس مرض أنيميا الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض أنيميا الطيور Reference Antiserum for Avian Chicken anemia virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
انتيجين مرجعي لفيروس مرض أنيميا الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض أنيميا الطيور Reference Antigen for Avian Chicken Anemia virus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 2 0
انتيجين مرجعي لفيروس مرض الجدري في الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الجدري في الطيور Reference Antigen for Avian Pox Virus Disease Non-infectious. Lyophilized, Fully Identified (including virus concentration) عبوة 3 0
سيرم مرجعي لفيروس مرض الجدري في الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الجدري في الطيور Reference Antiserum for Avian Pox Virus Disease Non-infectious. Lyophilized, FullyIdentified (including virus concentration) عبوة 4 0
سيرم مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور Reference Antiserum for Infectious LaryngeotracheitisVirus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 5 0

5 بند

جدول 65 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض التهاب الحنجرة والقصبة الهوائية المعدي في الطيور Reference Antigen for infectious Laryngeotracheitis Virus disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 1 0
سيرم مرجعي لفيروس مرض الريو في الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض الريو في الطيور Reference Antiserum for Reovirus Disease Non-infectious. Lyophilized, Fully identified (including Antibody concentration) عبوة 2 0
انتيجين مرجعي لفيروس مرض الريو في الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض الريو في الطيور Reference Antigen for Reovirus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 3 0
انتيجين مرجعي لفيروس مرض النيمو في الطيور 29 تجهيزات مخبرية انتيجين مرجعي لفيروس مرض النيمو في الطيور Reference Antigen for Pneumovirus Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 4 0
سيرم مرجعي لفيروس مرض النيمو في الطيور 29 تجهيزات مخبرية سيرم مرجعي لفيروس مرض النيمو في الطيور Reference Antiserum for Pneumovirus disease Non-infectious. Lyophilized, Fully identified (including antibody concentration) عبوة 5 0
انتيجين مرجعي لفيروس النزيف الدموي المعدي في الأرانب 3 تجهيزات مخبرية انتيجين مرجعي لفيروس النزيف الدموي المعدي في الأرانب Reference Antigen for Rabbit Hemorrhagic Septicemia viral disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 6 0
انتيجين مرجعي لفيروس الالتهاب الوبائي الرعاش في الدجاج 1 تجهيزات مخبرية Reference Antigen forAvian Encephalomyeilitis Disease Non-infectious. Lyophilized, Fully identified (including virus concentration) عبوة 7 0
سيرم مرجعي لفيروس الالتهاب الوبائي الرعاش في الدجاج 1 تجهيزات مخبرية Reference Antiserum for Avian Encephalomyeilitis disease Non-infectious. Lyophilized, Fully identified (including antibody concentration) عبوة 8 0
سيرم مرجعي لفيروس النزيف الدموي في الأرانب 3 تجهيزات مخبرية Reference Antiserum for Rabbit Haemorrahgic Septcaemia Virus disease Non-infectious. Lyophilized, Fully identified (including antibody concentration) عبوة 9 0

9 بند

جدول 66 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع O 3 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (O) Reference PCR Antigen for FMDV type O: Non –infectious.Lyophilized عبوة 1 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع A 7 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (A) Reference PCR Antigen for FMDV type A: Non –infectious.Lyophilized عبوة 2 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع Asia1 7 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (Asia1) Reference PCR Antigen for FMDV type Asia1: Non –infectious.Lyophilized عبوة 3 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع SAT1 3 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (SAT1) Reference PCR Antigen for FMDV type SAT1: Non –infectious.Lyophilized عبوة 4 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع SAT2 3 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (SAT2) Reference PCR Antigen for FMDV type SAT2: Non –infectious.Lyophilized عبوة 5 0
انتيجين مرجعي لاختبار PCR لفيروس الحمى القلاعية النوع SAT3 7 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الحمى القلاعية النوع (SAT3) Reference PCR Antigen for FMDV type SAT3: Non –infectious.Lyophilized عبوة 6 0
انتيجين مرجعي لاختبار PCR لفيروس جدري الاغنام 3 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس جدري الأغنام Reference PCR Antigen for Sheep Pox virus: Non –infectious.Lyophilized عبوة 7 0
انتيجين مرجعي لاختبار PCR لفيروس جدري الابل 6 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس جدري الأبل Reference PCR Antigen for Camel Pox virus: Non –infectious.Lyophilized عبوة 8 0
انتيجين مرجعي لفيروس مرض إلتهاب الجلد العقدي 7 تجهيزات مخبرية انتيجين مرجعي لفيروس الجلد العقدي Reference PCR Antigen for Lumpy Skin Disease virus: Non –infectious.Lyophilized عبوة 9 0
انتيجين المرجعي لاختبار PCR لفيروس اللسان الأزرق 13 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس اللسان الأزرق Reference PCR Antigen for Blue Tongue virusfor all the availble strains(serotypes(36): Non –infectious.Lyophilized عبوة 10 0
انتيجين مرجعي لاختبار pcr لفايروس طاعون المجترات 14 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس طاعون المجترات Reference PCR Antigen for PPR virus: Non –infectious. Lyophilized عبوة 11 0
انتيجين مرجعي لاختبار pcr لفايروس الاسهال البقرى 7 تجهيزات مخبرية انتيجين مرجعي لأختبارPCR لفيروس الاسهال البقرى Reference PCR Antigen for BVDV virus: Non –infectious. Lyophilized عبوة 12 0
امصال مرجعية لفيروسات مرض الحمى القلاعية لتقييم مشخصات الاليزا 7 تجهيزات مخبرية reference antisera for FMDV (pirbright panel) (lyophilized 1 ml),prefer with known titers to help in titeration, for serotype O, A, Asia1, SAT1, SAT2 and SAT3 عبوة 13 0
امصال مرجعية لفيروس مرض اللسان الازرق لتقييم مشخصات الاليزا 3 تجهيزات مخبرية reference antisera for BTV (pirbright panel) (lyophilized 1 ml),prefer with known titers to help in titeration. عبوة 14 0
امصال مرجعية لفيروس مرض طاعون المجترات الصغيرة لتقييم مشخصات الاليزا 4 تجهيزات مخبرية reference antisera against PPR virus (lyophilized 1 ml) عبوة 15 0

15 بند

جدول 67 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
انتيجين المرجعي لاختبار rt PCR لفيروس التهاب الشرايين الفيروسي في الخيل 3 تجهيزات مخبرية Reference RT-rt PCR Antigen for equine arterities virus: Non –infectious.Lyophilized عبوة 1 0
انتيجين المرجعي لاختبار rt PCR لفيروس طاعون الخيل الافريقي 7 تجهيزات مخبرية Reference RT-rt PCR Antigen for african horse sickness virus: Non –infectious.Lyophilized عبوة 2 0
انتيجين مرجعي لأختبارreal time PCR لفيروس انفلونزا الخيل 7 تجهيزات مخبرية Reference RT-rt PCR Antigen for equine influenza H3, N8, M2 virus: Non –infectious.Lyophilized عبوة 3 0
انتيجين المرجعي لاختبار rt PCR لفيروس هيربس 1و4 الخيلي 3 تجهيزات مخبرية Reference RT-rt PCR Antigen for equine herpes 1 & 4, virus: Non –infectious.Lyophilized عبوة 4 0
سيرم مرجعي لفيروس مرض التهاب الشرايين الفيروسي في الخيل 3 تجهيزات مخبرية reference antisera for equine viral arterities (lyophilized 1 ml) عبوة 5 0
سيرم مرجعي لفيروس مرض طاعون الخيل الافريقي 7 تجهيزات مخبرية reference antisera for african horse sickness (lyophilized 1 ml) عبوة 6 0
سيرم مرجعي لفيروس مرض انفلونزا الخيل H3 N8 M2 3 تجهيزات مخبرية reference antisera for equine influenza M2, & H3, N8 (lyophilized 1 ml) عبوة 7 0
سيرم مرجعي لفيروس مرض هربس 1 و 4 6 تجهيزات مخبرية reference antisera for equine herpes 1 & 4 (lyophilized 1 ml) عبوة 8 0
سيرم مرجعي لفيروس مرض للسان الازرق 7 تجهيزات مخبرية reference antisera for bluetongue virus (lyophilized 1 ml) عبوة 9 0
سيرم مرجعي لانماط المصلية لفيروس مرض للسان الازرق 27 عترة 13 تجهيزات مخبرية reference antisera for bluetongue virus (27 serotypes) (lyophilized 1 ml) عبوة 10 0
سيرم مرجعي ضد فيروس مرض حمى الوادي المتصدعIgG 14 تجهيزات مخبرية reference antisera against Rift Vally Fever virus (IgG)(lyophilized 1 ml) عبوة 11 0
سيرم مرجعي ضد فيروس مرض حمى الوادي المتصدعIgM 7 تجهيزات مخبرية reference antisera against Rift Vally Fever virus (IgM)(lyophilized 1 ml) عبوة 12 0
انتيجن مرحعي لفيروس حمى الوادي المتصدع 7 تجهيزات مخبرية Refernce Anigen fo Rit vally Fever virus For PCR test عبوة 13 0
سيرم مرجعي ضد فيروس انيميا الخيل المعدي 3 تجهيزات مخبرية reference antisera against Equine infectious Anemia virus (lyophilized 1 ml) عبوة 14 0
انتجينات مرجعية لفيروس مرض طاعون المجترات الصغيرة تشمل السلالات الأربع لتقييم مشخصات البى سى آر 4 تجهيزات مخبرية Reference Antigen of Peste des petits ruminants virus( LENEAGE 1,2,3,4) :Non –infectious.Lyophilized for PCR test عبوة 15 0

15 بند

جدول 68 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
عترة مرجعية لبكتيريا السالمونيلا 3 تجهيزات مخبرية عترة مرجعية للسالمونيلا Reference strain for Salmonella Lyophilized, Fully identified (including concentration) عبوة 1 0
عترة مرجعية لبكتيريا الاي كولاى O157 3 تجهيزات مخبرية عترة مرجعية للإي كولاى Reference strain for E.coli o157 Lyophilized, Fully identified (including concentration) عبوة 2 0
عترة مرجعية لبكتيريا الاي كولاى 3 تجهيزات مخبرية عترة مرجعية للإي كولاى Reference strain for E.coli Lyophilized, Fully identified (including concentration) عبوة 3 0
عترة مرجعية كامبيلوباكتر فيتس 3 تجهيزات مخبرية عترة مرجعية كامبيلوباكتر فيتس Reference strain Campylobacter foetus ,Fully identified ,Lypholized. عبوة 4 0
عترة مرجعية لبكتيريا الكامبيلوباكتر جيوجيني 3 تجهيزات مخبرية عترة مرجعية للكامبيلوباكتر جيوجيني Reference strain for campylobacter jejuni Lyophilized, Fully identified (including concentration) عبوة 5 0
عترة مرجعية كلوستريديوم بيرفرنجنس 3 تجهيزات مخبرية عترة مرجعية كلوستريديوم بيرفرنجنس Reference strain for clostridium perfringen Lyophilized, Fully identified (including concentration) عبوة 6 0
عترة مرجعية ليستيريا مونوستوجنس 6 تجهيزات مخبرية عترة مرجعية ليستيريا مونوستوجنس Reference strain for listeria monocytogenes Lyophilized, Fully identified (including concentration) عبوة 7 0
عترة مرجعية لبكتيريا مانهيميا هيموليتكا 6 تجهيزات مخبرية عترة مرجعية لبكتيريا مانهيميا هيموليتكا Reference strain for Manhemmia hemolytica fully identified عبوة 8 0
عترة مرجعية موجبة باستيرلا مولتسيدا 6 تجهيزات مخبرية Reference stain Pasturella multocida ,Lypholized, fully identifiedعترة مرجعية باستيرلا مولتسيدا عبوة 9 0
عترة مرجعية لبكتيريا استافيلوكوكاس أوريس 6 تجهيزات مخبرية عترة مرجعية استافيلوكوكاس أوريس Reference strain for Staphylococcus aureus Lyophilized, Fully identified (including concentration) عبوة 10 0
عترة مرجعية للمايكوبلازما مايكويدس 2 تجهيزات مخبرية Mycoplasma mycoides subsp. mycoides: reference strain :      Lyophilized,, Fully identified. عبوة 11 0
عترة مرجعية للمايكوبلازما كابريكولوم 2 تجهيزات مخبرية Mycoplasma capricolum subsp. capricolum: reference strain:    Lyophilized,, Fully identified. عبوة 12 0
عترة مرجعية للمايكوبلازما كابرينيموني 2 تجهيزات مخبرية Mycoplasma capricolum subsp. capripneumoniae: reference strain (Gabes strain):    Lyophilized,, Fully identified. عبوة 13 0
عترة مرجعية للمايكوبلازما كابري 2 تجهيزات مخبرية Mycoplasma mycoides subsp. capri: reference strain: Lyophilized,, Fully identified. عبوة 14 0
عترة مرجعية للمايكوبلازما أوفينموني 2 تجهيزات مخبرية Mycoplasma ovipneumoniae reference strain:   Lyophilized,, Fully identified. عبوة 15 0

15 بند

جدول 69 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
عترة مرجعية للمايكوبلازما اقلاكشيا 2 تجهيزات مخبرية Mycoplasma agalactiae reference strain: Lyophilized,, Fully identified. عبوة 1 0
عترة مرجعية كلوستريديم سبتكم 6 مشخص عترة مرجعية كلوستريديم سبتكم Refernce strain Clostridiumm septicum , fully characterized, lypholized عبوة 2 0
عترة مرجعية كلوستريديم سوردللي 6 مشخص عترة مرجعية كلوستريديم سوردللي Refernce strain Clostridiumm sordellii , fully characterized, lypholized عبوة 3 0
انتيجين مرجعي لبكتيريا الكلوستيرديوم نوفياي B 6 مشخص Reference PCR Antigen for Clostridium novyi B Non-infectious. Lyophilized, Fully identified (including concentration) عبوة 4 0
عترة مرجعية كلوستريديم شوفياي 6 مشخص عترة مرجعية كلوستريديم شوفياي Refernce strain Clostridiumm chauvoei , fully characterized, lypholized عبوة 5 0
عترة مرجعية كلوستريديوم بيرفرنجنس النوع A 6 تجهيزات مخبرية عترة مرجعية كلوستريديوم بيرفرنجنس Reference strain for clostridium perfringen Type A Lyophilized, Fully identified (including concentration) عبوة 6 0
عترة مرجعية كلوستريديوم بيرفرنجنس النوع B 6 تجهيزات مخبرية عترة مرجعية كلوستريديوم بيرفرنجنس Reference strain for clostridium perfringen Type B Lyophilized, Fully identified (including concentration) عبوة 7 0
عترة مرجعية كلوستريديوم بيرفرنجنس النوع C 6 تجهيزات مخبرية عترة مرجعية كلوستريديوم بيرفرنجنس Reference strain for clostridium perfringen Type C Lyophilized, Fully identified (including concentration) عبوة 8 0
عترة مرجعية كلوستريديوم بيرفرنجنس النوع D 6 تجهيزات مخبرية عترة مرجعية كلوستريديوم بيرفرنجنس Reference strain for clostridium perfringen Type D Lyophilized, Fully identified (including concentration) عبوة 9 0
عترة مرجعية كلوستريديوم نوفياي النوع A 6 تجهيزات مخبرية عترة مرجعية كلوستريديوم نوفياي Reference strain for clostridium novyii Type A Lyophilized, Fully identified (including concentration) عبوة 10 0
عترة مرجعية كلوستريديوم نوفياي النوع B 6 تجهيزات مخبرية عترة مرجعية كلوستريديوم بيرفرنجنس Reference strain for clostridium novyii Type B Lyophilized, Fully identified (including concentration) عبوة 11 0
عترة مرجعية لبكتيريا مايكوباكتيريم بارا تيوبركلوسيس 6 تجهيزات مخبرية عترة مرجعية لبكتيريا مايكوباكتيريم باراتيوبر كلوسيس Reference strain Mycobacterium paratuberculosis,lypholized , fully identified عبوة 12 0
عترة مرجعية لبكتيريا كوسيلا بيرنتي 6 تجهيزات مخبرية عترة مرجعية لبكتيريا كوسيلا بيرنتي Reference strain Coxiella burnettii , lypholized , fully identified عبوة 13 0
عترة مرجعية بكتيريا كلاميدوفيليا ابورتس 6 تجهيزات مخبرية عترة مرجعية بكتيريا كلاميدوفيليا ابورتس Refernce strain Chlamydophilia abortus عبوة 14 0
عترة مرجعية بكتيريا مايكوباكتيريم بوفس 6 تجهيزات مخبرية عترة مرجعية مايكوباكتيريم بوفس Reference strain Mycobacterium bovis , lypholized , fully identified عبوة 15 0

15 بند

جدول 70 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
عترة مرجعية بكتيريا بروسيلا ابورتس العترة 19 6 تجهيزات مخبرية عترة مرجعية مايكوباكتيريم بوفس Reference strain Brucella abortus , lypholized , fully identified عبوة 1 0
عترة مرجعية بكتيريا بروسيلا ملتنسيس ريف 1 6 تجهيزات مخبرية عترة مرجعية لبكتيريا بروسيلا ملتنسيس Reference strain brucella meletensis Rev-1 ,lypholized , fully identified عبوة 2 0
عترة مرجعية بكتيريا بروسيلا أوفيس 6 تجهيزات مخبرية عترة مرجعية بكتيريا بروسيلا أوفيس reference strain Brucella ovis , lypholized, fully identified عبوة 3 0
عترة مرجعية بكتيريا بروسيلا ابورتس عترة RB 51 6 تجهيزات مخبرية عترة بكتيريا بروسيلا ابورتس عترة Brucella abortus strain RB51 عبوة 4 0
عترة مرجعية كلبسيلا نيموني مع الشهادة الخاصة ب 2017 ISO 17025 6 تجهيزات مخبرية Klebsiella pneumoniae reference strain Lyophilized, Fully identified عبوة 5 0
عترة مرجعية للسودوموناس ايروجينوزا مع الشهادة الخاصة ب 2017 ISO 17025 6 تجهيزات مخبرية Pseudomonas aeruginosa reference strain. Lyophilized, Fully identified عبوة 6 0
عتره مرجعية للمكورات السبحية الخيلية 6 تجهيزات مخبرية Streptcoccus equi reference strain - Lyophilized, Fully identified عبوة 7 0
عترة مرجعية للكامبيلوباكتر جيجيناي مع الشهادة الخاصة ب 2017 ISO 17025 6 تجهيزات مخبرية Campylobacter jejuni reference strain Lyophilized, Fully identified عبوة 8 0
عترة مرجعية للكوراينيباكتريوم يورليتكم مع الشهادة الخاصة ب 2017 ISO 17025 6 تجهيزات مخبرية Corynebacterium urealyticum reference strain Lyophilized, Fully identified عبوة 9 0
عترة مرجعية للانتيروباكتر هورميشي مع الشهادة الخاصة ب 2017 ISO 17025 6 تجهيزات مخبرية Enterobacter hormaechei reference strain Lyophilized, Fully identified عبوة 10 0

10 بند

جدول 71 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
سيرم مرجعي أيجابي للمايكوبلازما أجالاكسي 11 مشخص سيرم مرجعي للمايكوبلازما أجالاكسي Hyperimmune antisera against Mycoplasma agalactiae: - Lyophilized. - 1ml/container. عبوة 1 0
سيرم مرجعي إيجابي للمايكوبلازما كابرينموني 11 مشخص سيرم مرجعي للمايكوبلازما كابرينموني Hyperimmune antisera against Mycoplasma capricolum subsp. Capripneumoniae - Lyophilized. - 1ml/container عبوة 2 0
سيرم مرجعي أيجابي للمايكوبلازما كابريكولوم 11 مشخص سيرم مرجعي للمايكوبلازما كابريكولوم Hyperimmune antisera against Mycoplasma capricolum subsp. capricolum: ة- Lyophilized. - 1ml/container عبوة 3 0
سيرم مرجعي إيجابي للمايكوبلازما كابري 11 مشخص سيرم مرجعي للمايكوبلازما كابري Hyperimmune antisera against Mycoplasma mycoides subsp. capri: - Lyophilized.- 1ml/container عبوة 4 0
سيرم مرجعي أيجابي للمايكوبلازما مايكويديس 11 مشخص سيرم مرجعي للمايكوبلازما مايكويديس Hyperimmune antisera against Mycoplasma mycoides subsp. Mycoides: - Lyophilized. - 1ml/container عبوة 5 0
سيرم مرجعي أيجابي للمايكوبلازما أوفينموني 11 مشخص سيرم مرجعي للمايكوبلازما أوفينموني Hyperimmune antisera against Mycoplasma ovipneumoniae: - Lyophilized. - 1ml/container عبوة 6 0
سيرم مرجعي سلبي لكل أنواع المايكوبلازما 11 مشخص سيرم مرجعي سلبي لكل أنواع المايكوبلازما Reference antiseum negative for all types of Mycoplasma عبوة 7 0
سيرم مرجعى إيجابى ضعيف لمرض الرعام في الخيول 11 مشخص Reference antisera (weak) against Burkholderia mallei Lyophilized. - 1ml/container- عبوة 8 0
سيرم مرجعى سلبي لمرض الرعام في الخيول 11 مشخص Reference antisera (negative) against Burkholderia mallei Lyophilized. - 1ml/container- عبوة 9 0
سيرم مرجعى إيجابى قوي لمرض الرعام في الخيول 11 مشخص Reference antisera (strong) against Burkholderia mallei Lyophilized. - 1ml/container- عبوة 10 0
سيرم مرجعى إيجابى قوى لمرض خناق الخيل في الخيول 11 مشخص Reference antisera (strong) against Strept equi Lyophilized. - 1ml/container- عبوة 11 0
سيرم مرجعى سلبي لمرض خناق الخيل في الخيول 11 مشخص Reference antisera (negative) against Strept equi Lyophilized. - 1ml/container- عبوة 12 0
سيرم مرجعى لمرض إيجابى خناق الخيل في الخيول 11 مشخص Reference antisera against Strept equi Lyophilized. - 1ml/container- عبوة 13 0
سيرم مرجعى لمرض إيجابى ضعيف خناق الخيل في الخيول 11 مشخص Reference antisera (weak) against Strept equi Lyophilized. - 1ml/container- عبوة 14 0

14 بند

جدول 72 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
بادئات GAATATTAAACAATGCGCAG لمرض السرة 2 تجهيزات مخبرية بادئات (GAATATTAAACAATGCGCAG) لمرض السرة حبة 1 0
بادئات CCATTTATTAGCTTTGTTGC لمرض السرة 2 تجهيزات مخبرية بادئات (CCATTTATTAGCTTTGTTGC ) لمرض السرة حبة 2 0
بادئات GCGGGGTGTTTAAAGCAATA لمرض السرة 2 تجهيزات مخبرية بادئات (GCGGGGTGTTTAAAGCAATA) لمرض السرة حبة 3 0
بادئات ATTAGTGCTGCGTGTGTTCG لمرض السرة 2 تجهيزات مخبرية بادئات (ATTAGTGCTGCGTGTGTTCG) لمرض السرة حبة 4 0
عينه مرجعيه حمض نووي DNA لطفيل T evansi 2 تجهيزات مخبرية عينه مرجعيه (حمض نووي DNA) لطفيل T.evansi عبوة 5 0

5 بند

جدول 73 المواد - توريد مستلزمات طبية

البند الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
طقم rtqPCR لفيروس مرض الحمى القلاعية عام يتوافق مع اجهزة شركة روش ABI BioRad 2381 تجهيزات مخبرية FMD Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of FMDV virus(all serotypes) contains all reagents and controls:(contains PCR Master Mix, lyophilized primer/probe (taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control ,Endogenous control PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target, Supply with quality control certificate and validation report data. اختبار 1 0
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع O يتوافق مع اجهزة شركة روش ABI BioRad 952 تجهيزات مخبرية FMD type O Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of FMDV serotype O contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control Endogenous control PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target, Supply with quality control certificate and validation report data. اختبار 2 0
طقم rtqPCR لفيروس مرض الحمى القلاعية النوع A يتوافق مع اجهزة شركة روش ABI BioRad 952 تجهيزات مخبرية FMD type A Real-Time PCR Detection kit compatible with Roche ,ABI and Biorad systems: One-step real-time qPCR kit for detection of FMDV serotype A contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control Endogenous control PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target, Supply with quality control certificate and validation report data. اختبار 3 0
طقم rt PCR لفيروس مرض الحمى القلاعية النوع SAT2 يتوافق مع اجهزة شركة روش ABI BioRad 952 تجهيزات مخبرية FMD type SAT2 Real-Time PCR Detection kit: One-step real-time qPCR kit for detection of FMDV serotype SAT2 contains all reagents and controls : (contains PCR Master Mix, lyophilized primer/probe(taqman application) compatible with Roche, BioRad, ABI machines, Internal extraction control Endogenous control PCR grad water, Positive and negative controls). Highly specific detection profile, Sensitive to 10 copies of target, Supply with quality control certificate and validation report data. اختبار 4 0

4 بند

المستندات الداعمة (8 ملف)

القائمة الإلزامية للجهات الحكومية مارس 2025.zip

معلق
فتح

نموذج تاهيل بسيط - محدث 3.zip

معلق
فتح

الشروط والأحكام لآلية التفضيل السعري للمنتج الوطني.pdf

معلق
فتح

تقييم العروض.pdf

معلق
فتح

جدول الاستلام.pdf

معلق
فتح

الشروط الخاصصةة.pdf

معلق
فتح

الغرامات.pdf

معلق
فتح

التعليمات الخاصة بتسليم المنتجات الوطنية 2024 1.pdf

معلق
فتح

لم يتم ترسية هذه المنافسة بعد

الآليات

القائمة الإلزامية

آلية التفضيل السعري للمنتج الوطني

وثائق المحتوى المحلي

معايير التقييم

معايير التقييم الفني

المستوى الاول المستوى الثاني المستوى الثالث الوزن النهائي
التقييم الفني

معايير التقييم المالي

المستوى الاول المستوى الثاني المستوى الثالث الوزن النهائي
التقييم المالي السعر التكلفة الكلية 100%

أخبار المنافسة

title تاريخ الإنشاء
value 03/11/46 11:08:21 ص
title تاريخ فتح العروض
value 04/01/47 10:00:00 ص
title تمديد تواريخ المنافسة
value تاريخ فتح العروض04/01/47 10:00:00 صآخر موعد لتقديم العروض04/01/47 10:00:00 صآخر موعد لإستلام الإستفسارات23/12/46 12:00:00 ص